ID: 942668584

View in Genome Browser
Species Human (GRCh38)
Location 2:178349267-178349289
Sequence ATCTGCACAAAGGTTGGGGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 188}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942668584_942668593 20 Left 942668584 2:178349267-178349289 CCAACCCCAACCTTTGTGCAGAT 0: 1
1: 0
2: 1
3: 20
4: 188
Right 942668593 2:178349310-178349332 TAGCCACCTCACTGACCCTCTGG 0: 1
1: 1
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942668584 Original CRISPR ATCTGCACAAAGGTTGGGGT TGG (reversed) Exonic
900726046 1:4216919-4216941 ATCTGCAAAAGGCCTGGGGTAGG + Intergenic
901638191 1:10680045-10680067 TCCTGCAGAAAGGCTGGGGTGGG + Intronic
901855616 1:12042595-12042617 ATCTGCAGAAAGGCTGGGCATGG - Intergenic
902221504 1:14968828-14968850 ATCGGCACAAGCTTTGGGGTAGG - Intronic
902826528 1:18978481-18978503 ATCTGAAGACAGCTTGGGGTAGG - Intergenic
905654500 1:39677353-39677375 ATATGGTCAAGGGTTGGGGTGGG - Intergenic
908145361 1:61235523-61235545 AAATGAACAAAGGTTGGGTTTGG + Intronic
911233870 1:95388730-95388752 CTTTGCACACAGGTTTGGGTGGG + Intergenic
912436449 1:109665328-109665350 CTCAGAACAAAGGTGGGGGTGGG - Intronic
912438540 1:109680052-109680074 CTCAGAACAAAGGTGGGGGTGGG - Intronic
912441058 1:109698506-109698528 CTCAGAACAAAGGTGGGGGTGGG - Intronic
914048877 1:144114837-144114859 AGCTGCACAAACCTGGGGGTGGG - Intergenic
914130307 1:144850611-144850633 AGCTGCACAAACCTGGGGGTGGG + Intergenic
914754438 1:150554642-150554664 GTCTGCAGAAGGGTCGGGGTGGG + Intronic
914880040 1:151540121-151540143 ATTTACACAAAGGTGGGGCTTGG - Intergenic
915545864 1:156597368-156597390 TCCTCCACAAAGGTTGGGGTGGG + Intronic
915566374 1:156715679-156715701 CTCTGCACAATGTCTGGGGTGGG - Intergenic
915817659 1:158986653-158986675 ATCTGCTCAAAGGGTGGGGCTGG - Intergenic
915954658 1:160211705-160211727 AGCTGGACAAAGGTGGGGGAGGG + Exonic
923644349 1:235801457-235801479 ATTTTCACAAAGATTTGGGTAGG - Intronic
1063171963 10:3517131-3517153 AGCTGCACACAGCTTGGGGAGGG + Intergenic
1063905908 10:10779938-10779960 CACTGCAGAAAGGTTTGGGTGGG + Intergenic
1064129024 10:12691180-12691202 AACTGAAGAAAGGCTGGGGTGGG + Intronic
1064466770 10:15590937-15590959 ATCTATACAAAGTTTGGGGTGGG + Intronic
1064636300 10:17371313-17371335 ATCTGCAAAGAGGTTCAGGTGGG + Intronic
1065499325 10:26363749-26363771 ATCTACTCAAAGGCTGAGGTGGG - Intergenic
1066406076 10:35119827-35119849 ATCTCAACACAGGTTGAGGTAGG - Intergenic
1069213998 10:65796845-65796867 CTATGCACCAAGTTTGGGGTGGG + Intergenic
1071934021 10:90506675-90506697 AATAGCACAAAGGATGGGGTAGG + Intergenic
1073180869 10:101582419-101582441 ATCTGTACTGAGGTTAGGGTGGG - Intronic
1074437100 10:113443513-113443535 ATCTTCACAAAGGTTTGGATGGG - Intergenic
1075815312 10:125260472-125260494 ATGTGTACATAGGATGGGGTGGG + Intergenic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1079006372 11:16794136-16794158 ATTTGCACAAAGGTTTGCATGGG + Intronic
1079307778 11:19338906-19338928 ATCTGCAGAATGGCTGTGGTGGG - Intergenic
1079520177 11:21316897-21316919 ATAAGCACAAAGGCTGGGGTGGG + Intronic
1079717873 11:23771195-23771217 ATCTGGATAAAGGATGGGATTGG - Intergenic
1081482582 11:43503486-43503508 ATCTACAGAAATTTTGGGGTTGG - Intergenic
1081484976 11:43520579-43520601 GTCTGGAGGAAGGTTGGGGTTGG - Intergenic
1084746944 11:71177373-71177395 AATAGCACAAAGGTTGGAGTGGG + Intronic
1085456623 11:76669127-76669149 ATCATCACAATAGTTGGGGTTGG - Intronic
1085782626 11:79423294-79423316 ATCTGTACAATGGCGGGGGTGGG - Intronic
1086934961 11:92734951-92734973 ATCTGAACTAAGGTAGGGGATGG + Intronic
1087111368 11:94472779-94472801 ATTTGCACATATGTTGGGGATGG - Intronic
1089497262 11:118914035-118914057 ACCTGCACCAGGGTGGGGGTAGG + Intronic
1092199177 12:6569375-6569397 CTCAGCACAAAGGTGGGGGCAGG - Intergenic
1093761641 12:22917441-22917463 TTCTGAACAAATGTTGGTGTGGG + Intergenic
1095123439 12:38445280-38445302 ATCTGAACCAAATTTGGGGTTGG + Intergenic
1095948459 12:47767175-47767197 AACTCCACAAGGGCTGGGGTGGG + Intronic
1095985987 12:48000124-48000146 CTCTGCACCAAGGGTGGGGAGGG + Exonic
1096870662 12:54590183-54590205 ATCTGCGCAAAGGTTGGGAATGG - Intergenic
1098128538 12:67323885-67323907 ATCTGCATACAAGTTGGGGAAGG + Intergenic
1098526430 12:71492149-71492171 TACTCCAGAAAGGTTGGGGTTGG + Intronic
1101898391 12:108772436-108772458 AGCTGCATAAAGGGTGGGGGAGG + Intergenic
1104341474 12:127953864-127953886 ATCGGAACATAGGTTGGGGCAGG + Intergenic
1105047610 12:133018341-133018363 ACCAGCACAAAAGTCGGGGTGGG + Exonic
1109193540 13:59353489-59353511 ATTTGCACAAAGGTTCAGGAAGG - Intergenic
1109669431 13:65585563-65585585 CTCTGCACCAAGGCTGGGGGAGG + Intergenic
1111626754 13:90797749-90797771 ACCTGCCCAAAGGTTTGGGAGGG + Intergenic
1112417359 13:99214733-99214755 CTCTCCAAAAAGGGTGGGGTGGG - Intronic
1116363399 14:44029575-44029597 CCCTCCACAAAGGTTGGGGATGG + Intergenic
1116857593 14:49966620-49966642 ATCTGCCTAAAGGGTGGGGCGGG - Intergenic
1117886480 14:60369532-60369554 ATCTGCACAAAGACTGGGAGTGG + Intergenic
1121105629 14:91277831-91277853 AGCTGCAGAAAGGATGGGGTGGG - Intronic
1122090210 14:99333703-99333725 ATCTGCAGAATGGTGGGGATGGG - Intergenic
1126113136 15:45187287-45187309 ATCTGAACAAAGGTGGGTGAAGG + Intronic
1126809714 15:52389577-52389599 AACTGCCCAAAGATTGGGCTGGG - Intronic
1128065515 15:64762164-64762186 ATCTTGCAAAAGGTTGGGGTAGG + Intronic
1128549825 15:68590928-68590950 ATTTGCACAAGGGTAGGGATGGG - Intronic
1128976117 15:72155073-72155095 AAATGCAAAAAGGTTGGGTTGGG - Intergenic
1129183223 15:73889948-73889970 AACTGCAGAAGGGTTGGGGCTGG + Intergenic
1129237730 15:74233893-74233915 AGCTGCCCAAATGTGGGGGTGGG + Intergenic
1129880446 15:79003290-79003312 AGGGGCACAGAGGTTGGGGTGGG - Intronic
1131712674 15:95073174-95073196 ATCTGCAGAAAGGCTGAGCTCGG - Intergenic
1133168960 16:3968730-3968752 ATACGCACAAAGATAGGGGTAGG - Intronic
1135952568 16:26928859-26928881 ATGTGCACAAAGGCTTGGCTTGG - Intergenic
1143633518 17:8151765-8151787 TTCTGCCCAAGGCTTGGGGTTGG - Intronic
1143746319 17:8996825-8996847 ATGTACACAAAGGTTTGGTTTGG + Intergenic
1144684344 17:17216206-17216228 ATCTTCACACAGGTAGCGGTGGG - Intronic
1146256510 17:31393939-31393961 ATATGCACACAGCTTAGGGTGGG + Intronic
1147525167 17:41215719-41215741 ACATGGACAAACGTTGGGGTGGG - Intronic
1148285777 17:46390262-46390284 ATCTCCAAAATAGTTGGGGTGGG + Intergenic
1148307940 17:46607883-46607905 ATCTCCAAAATAGTTGGGGTGGG + Intronic
1150247122 17:63684846-63684868 CTCTGCACAAAAGTTGGGGTGGG - Intronic
1151390741 17:73785224-73785246 ATCTGCAACATGGTAGGGGTGGG + Intergenic
1151506569 17:74531648-74531670 GTCTGCAGAAGGGGTGGGGTGGG + Intergenic
1152034240 17:77862144-77862166 CCCTGCATGAAGGTTGGGGTGGG + Intergenic
1152576255 17:81142581-81142603 CTCTGCTGAGAGGTTGGGGTGGG + Intronic
1155074166 18:22340659-22340681 ATCTGCACACAGGATGGGCCTGG - Intergenic
1155246609 18:23916624-23916646 GTCTGTCCAAAGGTTGGGATGGG - Exonic
1155357274 18:24965331-24965353 ATCAGAACAAAGTATGGGGTAGG - Intergenic
1158208955 18:55024572-55024594 CTCTGGACAAAGGTTTGGGTGGG - Intergenic
1158416660 18:57254877-57254899 GTCTGCAAGAAGGCTGGGGTGGG - Intergenic
1160063240 18:75550877-75550899 ATTTGCAGAAATCTTGGGGTGGG + Intergenic
1160517261 18:79485485-79485507 GCCGGCACAAAGGCTGGGGTGGG + Intronic
1161112596 19:2478560-2478582 ATGTGCCCAGAGCTTGGGGTTGG - Intergenic
1161884220 19:6981273-6981295 ATATGCACAAGTGTTGGAGTGGG + Intergenic
1162931640 19:13960569-13960591 CGCTGCACAAAGGTGGGGCTCGG + Exonic
1163821588 19:19499331-19499353 TTCTGCCCACAGGTTGAGGTTGG + Intronic
1164243530 19:23410740-23410762 ATTGGCACAAAGGTGGGGTTGGG - Intergenic
1165035795 19:33032718-33032740 ATGTTCACAAGGATTGGGGTGGG + Intronic
1165396968 19:35569732-35569754 ATCTGCACAAAGATGGGAGAGGG - Intergenic
1165491775 19:36127769-36127791 TCCTGCCCAAAGTTTGGGGTTGG + Intergenic
1165492916 19:36135471-36135493 ATCTGCTGACAGGTTGGAGTGGG + Intergenic
1202688328 1_KI270712v1_random:67740-67762 AGCTGCACAAACCTGGGGGTGGG - Intergenic
925026596 2:612504-612526 ATCTGCAAGATGGTTTGGGTGGG + Intergenic
925686703 2:6480683-6480705 GTCTACACAAAGCATGGGGTCGG + Intergenic
927030167 2:19112901-19112923 AGCTGCTCAAAGGTTTGGGAAGG - Intergenic
929649973 2:43668918-43668940 TTATGCACAAAGGTGGGGGAAGG + Intronic
929908213 2:46064926-46064948 ATCTACAGAAAGCTTGGGCTTGG - Intronic
932189850 2:69731704-69731726 ATCTGAGTAAAGGGTGGGGTAGG + Intronic
933958094 2:87388192-87388214 AGCTGCACAAACCTGGGGGTGGG + Intergenic
934242215 2:90280110-90280132 AGCTGCACAAACCTGGGGGTGGG + Intergenic
934270957 2:91536578-91536600 AGCTGCACAAACCTGGGGGTGGG - Intergenic
934895979 2:98120341-98120363 ATCTGGATAACGGTTGGGGAAGG + Intronic
935238170 2:101155191-101155213 AGCTGCTCAAAGGCTGAGGTGGG + Intronic
935553853 2:104485636-104485658 ATCCTCACAAAGGTTAGGTTTGG + Intergenic
937296976 2:120815384-120815406 TTCTGCCCAAAAGTTGGGGGCGG + Intronic
937324012 2:120978314-120978336 GTCTGCACACAGGTCGGGGAGGG + Intronic
938071465 2:128310591-128310613 ATCTTCACCACGGCTGGGGTAGG + Intronic
942668584 2:178349267-178349289 ATCTGCACAAAGGTTGGGGTTGG - Exonic
943981971 2:194564780-194564802 ATCTGCACATAGTTTGGAGTTGG - Intergenic
946989794 2:225315620-225315642 ATGGGTACAAATGTTGGGGTGGG + Intergenic
947815824 2:233035350-233035372 ACCTACACAAAGCTGGGGGTAGG - Intergenic
948689210 2:239691400-239691422 ACCTGCACACAGGCTGGGCTGGG + Intergenic
1168922533 20:1552419-1552441 ATCTCCACTGAGTTTGGGGTTGG + Intronic
1168924354 20:1566952-1566974 ATCTGCACTGGGGTTGAGGTAGG - Intronic
1170148898 20:13207141-13207163 ATCTGCAGAACAGGTGGGGTTGG + Intergenic
1170307961 20:14960358-14960380 GTCTGCACACAGGATGGTGTGGG - Intronic
1170956648 20:20986379-20986401 CTCTGCACAAAGGCTGAGGAAGG - Intergenic
1171012114 20:21514491-21514513 ATCTTAAAAAAGGTGGGGGTGGG + Intergenic
1171101667 20:22389405-22389427 ATCTGGACCAGGGGTGGGGTGGG + Intergenic
1175195679 20:57241736-57241758 GCCTGCACAGATGTTGGGGTAGG + Intronic
1177091026 21:16768800-16768822 ATCTGTAAAAATGATGGGGTTGG + Intergenic
1177943734 21:27442500-27442522 GCATGGACAAAGGTTGGGGTGGG + Intergenic
1179164406 21:38924573-38924595 ATCTGCAGGAAGGCTGGGGAGGG - Intergenic
1180222922 21:46370614-46370636 ATCTGCACACGGGCTGGGCTTGG + Intronic
1181420105 22:22792008-22792030 TTCAGCACAAAGCTTGGGGGTGG + Intronic
1183752310 22:39728537-39728559 ATCTGCCCTGAGGTGGGGGTTGG + Intergenic
1185419878 22:50729305-50729327 GACAGCACAGAGGTTGGGGTGGG + Intergenic
950141695 3:10620368-10620390 CTCTGGACAAAGTCTGGGGTTGG + Intronic
950397234 3:12742867-12742889 ATCTGTATAATGGGTGGGGTAGG - Intronic
951840469 3:27028349-27028371 ATCTGGCCAATGGTTGTGGTAGG + Intergenic
953410286 3:42687032-42687054 CCCTGCACAGGGGTTGGGGTGGG + Intronic
953921844 3:46957186-46957208 ACCTGCAGAGAGGTAGGGGTGGG + Intronic
954302307 3:49706465-49706487 ATCTGCTGACAGGTCGGGGTGGG - Intronic
954493983 3:50935384-50935406 ATCTGGAAAAATGTAGGGGTGGG + Intronic
956585720 3:70862357-70862379 ACCTACACAGAGGTTGGGGGAGG + Intergenic
961819756 3:129569956-129569978 ATCTGTGCAGAGGTTGGGGAAGG + Exonic
964874105 3:161346822-161346844 ATATGTACAAAGGTTGGAGGTGG + Intronic
965213323 3:165825407-165825429 GTCTTCACAAATGTTGGTGTAGG + Intronic
970930887 4:21510365-21510387 ATCAATACAAAGGTTGGGGTGGG + Intronic
972166953 4:36298214-36298236 ATGTGTACAAAGGATGGGGTTGG - Intronic
972759172 4:42085069-42085091 AGCTGCAAAAAGGGTAGGGTTGG - Intronic
973983103 4:56323234-56323256 ATCAGCACAGAGGTTGTGCTAGG + Intronic
976575194 4:86661912-86661934 ATCTGCATAAATCTTGGGGTTGG - Intronic
977312674 4:95406299-95406321 ATCTGCACTAATGTTGGGTTGGG + Intronic
977536875 4:98263769-98263791 ATCTGAACAAACATTTGGGTTGG + Intronic
977724450 4:100278993-100279015 TTATTCACAAATGTTGGGGTTGG + Intergenic
980002226 4:127503233-127503255 AGCTGTACAAAGGTCAGGGTTGG - Intergenic
982120104 4:152135025-152135047 ACATGCACAATGGTGGGGGTTGG + Intergenic
983328589 4:166292693-166292715 ATCTGCAGAAAGGTTAATGTGGG + Intergenic
988365382 5:30291403-30291425 ATCTGCATTAAGGTTGAGTTTGG + Intergenic
992279965 5:75164217-75164239 ATCAACAAAAAGTTTGGGGTTGG - Intronic
992359988 5:76027350-76027372 AACTGAAAAAAGGTTGGGCTTGG - Intergenic
992713487 5:79485365-79485387 ATATGTAAAAATGTTGGGGTGGG - Intronic
992988656 5:82260285-82260307 ATCTGCTCACAGGATAGGGTGGG - Intronic
993254650 5:85574241-85574263 ATCTGCATAGAGGGAGGGGTTGG - Intergenic
993274872 5:85844061-85844083 ATCTGCAAAGGGGATGGGGTGGG + Intergenic
994611887 5:102052402-102052424 ACGTGCACACAGGTAGGGGTGGG + Intergenic
996669125 5:126096527-126096549 GTCTGCAGAAAGGTTGGGGGAGG - Intergenic
996828110 5:127708614-127708636 ATCATCACAAAGGTTGGAGATGG - Intergenic
997604929 5:135168019-135168041 ATCTGTACAAAATTTGGGGCAGG + Intronic
997774954 5:136595200-136595222 AAATGCACAAAGGTCAGGGTGGG - Intergenic
998391519 5:141789901-141789923 ATCTTCCTAAAGGCTGGGGTAGG + Intergenic
1001324104 5:170707634-170707656 GTCAGCACAAATGTTGAGGTGGG - Intronic
1003564807 6:7214085-7214107 CTCTGCACAGAGGTTGGAGATGG + Intronic
1004449442 6:15731200-15731222 ACCTGAACAAAGGTTGAGGGAGG + Intergenic
1004522793 6:16378077-16378099 ACCTGCACACAGGTTGTGGTGGG - Intronic
1006195988 6:32242764-32242786 ATCTGTAAAGAGGTTGGGGCTGG + Intergenic
1006317414 6:33298753-33298775 TTCTGCAGGAAGGTTGGGGGAGG + Intronic
1006620900 6:35363251-35363273 GCCTGCACACAGGTTGGGCTAGG + Intronic
1006983167 6:38161863-38161885 GTCAGCCCAAAGGTTGGGGTGGG - Intergenic
1010060162 6:71613555-71613577 ATATGCACAAACCTTGGGGTGGG - Intergenic
1012532146 6:100250940-100250962 ATATGAACAAAAGATGGGGTTGG + Intergenic
1015160009 6:130142488-130142510 ACCTGCACAAAGGTTGTATTTGG - Intergenic
1019287513 7:231164-231186 GTCTGCATGATGGTTGGGGTCGG - Intronic
1020007038 7:4788627-4788649 ATCGGGACAAAGGCTGGCGTGGG - Intronic
1023533380 7:41182772-41182794 ATCTGGACAAAGTTTAGGGCAGG - Intergenic
1027729082 7:81846677-81846699 AGCTGCAGAACTGTTGGGGTGGG - Intergenic
1027832641 7:83199562-83199584 AACTTCACAAAAGTTGGGATAGG - Intergenic
1028889432 7:95970467-95970489 ATCTGCACAAAGGGTGTGCTGGG + Intronic
1029978113 7:104852867-104852889 ATCTGCCGGAAGGTGGGGGTGGG - Intronic
1031423352 7:121576117-121576139 ATCTGCACAAAGGAAGGACTTGG - Intergenic
1032284720 7:130531543-130531565 AGGGGCACAAAGGGTGGGGTGGG + Intronic
1032591273 7:133194222-133194244 ATTTGCTCCAAAGTTGGGGTGGG + Intergenic
1038420600 8:27431683-27431705 ATCTGCACAGAGGTGGTGGGAGG + Intronic
1040546072 8:48398764-48398786 ATCTGCACAAAGGCAGTTGTGGG - Intergenic
1045227646 8:100265738-100265760 AACAGTAGAAAGGTTGGGGTGGG + Intronic
1049011710 8:139891733-139891755 ATCTGCACACTTGTGGGGGTGGG + Intronic
1049443091 8:142618075-142618097 ATGTGTGCAAAGGGTGGGGTGGG - Intergenic
1049642831 8:143723074-143723096 ACCTGCCCATGGGTTGGGGTTGG + Intergenic
1056429427 9:86512407-86512429 ATTTGGACAAAGATTGAGGTAGG - Intergenic
1057129786 9:92646091-92646113 AACAGCACAAAGGTTGGGGGAGG + Intronic
1057157251 9:92853833-92853855 ATCTGAACCAAGTTTGGGGTGGG - Intronic
1058228403 9:102395316-102395338 ATCTGAGAAAAGGTTGGGGAAGG + Intergenic
1059815478 9:117908232-117908254 ATCTGCACATAGCTTGTGGGAGG + Intergenic
1186676432 X:11822234-11822256 AGCAGCAATAAGGTTGGGGTGGG - Intergenic
1187498313 X:19814943-19814965 ACCTGCTCAAAGCTGGGGGTGGG + Intronic
1189635606 X:43005131-43005153 ATGTGTACAAAGGAGGGGGTAGG + Intergenic