ID: 942674595

View in Genome Browser
Species Human (GRCh38)
Location 2:178413669-178413691
Sequence CCACCCAAGAGCAACGAAGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942674595_942674605 14 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674605 2:178413706-178413728 CCCTCTGAATTCGCCGGGCAGGG No data
942674595_942674603 13 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674603 2:178413705-178413727 TCCCTCTGAATTCGCCGGGCAGG No data
942674595_942674602 9 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674602 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
942674595_942674608 28 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674608 2:178413720-178413742 CGGGCAGGGATACAGCCGCCCGG No data
942674595_942674609 29 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674609 2:178413721-178413743 GGGCAGGGATACAGCCGCCCGGG No data
942674595_942674610 30 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data
942674595_942674600 8 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674600 2:178413700-178413722 CCCGCTCCCTCTGAATTCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942674595 Original CRISPR CCACCCAAGAGCAACGAAGA CGG (reversed) Intergenic
No off target data available for this crispr