ID: 942674598

View in Genome Browser
Species Human (GRCh38)
Location 2:178413692-178413714
Sequence TTCAGAGGGAGCGGGCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942674598_942674605 -9 Left 942674598 2:178413692-178413714 CCGCGGCGCCCGCTCCCTCTGAA No data
Right 942674605 2:178413706-178413728 CCCTCTGAATTCGCCGGGCAGGG No data
942674598_942674610 7 Left 942674598 2:178413692-178413714 CCGCGGCGCCCGCTCCCTCTGAA No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data
942674598_942674614 25 Left 942674598 2:178413692-178413714 CCGCGGCGCCCGCTCCCTCTGAA No data
Right 942674614 2:178413740-178413762 CGGGGCCTCTTGCTCGTGCTTGG No data
942674598_942674603 -10 Left 942674598 2:178413692-178413714 CCGCGGCGCCCGCTCCCTCTGAA No data
Right 942674603 2:178413705-178413727 TCCCTCTGAATTCGCCGGGCAGG No data
942674598_942674608 5 Left 942674598 2:178413692-178413714 CCGCGGCGCCCGCTCCCTCTGAA No data
Right 942674608 2:178413720-178413742 CGGGCAGGGATACAGCCGCCCGG No data
942674598_942674609 6 Left 942674598 2:178413692-178413714 CCGCGGCGCCCGCTCCCTCTGAA No data
Right 942674609 2:178413721-178413743 GGGCAGGGATACAGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942674598 Original CRISPR TTCAGAGGGAGCGGGCGCCG CGG (reversed) Intergenic
No off target data available for this crispr