ID: 942674601

View in Genome Browser
Species Human (GRCh38)
Location 2:178413701-178413723
Sequence CCCGGCGAATTCAGAGGGAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942674601_942674610 -2 Left 942674601 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data
942674601_942674614 16 Left 942674601 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
Right 942674614 2:178413740-178413762 CGGGGCCTCTTGCTCGTGCTTGG No data
942674601_942674616 24 Left 942674601 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
Right 942674616 2:178413748-178413770 CTTGCTCGTGCTTGGTTTTCCGG No data
942674601_942674608 -4 Left 942674601 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
Right 942674608 2:178413720-178413742 CGGGCAGGGATACAGCCGCCCGG No data
942674601_942674609 -3 Left 942674601 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
Right 942674609 2:178413721-178413743 GGGCAGGGATACAGCCGCCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942674601 Original CRISPR CCCGGCGAATTCAGAGGGAG CGG (reversed) Intergenic
No off target data available for this crispr