ID: 942674602

View in Genome Browser
Species Human (GRCh38)
Location 2:178413701-178413723
Sequence CCGCTCCCTCTGAATTCGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942674593_942674602 12 Left 942674593 2:178413666-178413688 CCGCCGTCTTCGTTGCTCTTGGG No data
Right 942674602 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
942674587_942674602 30 Left 942674587 2:178413648-178413670 CCCATCCTCTCCTCCGCGCCGCC No data
Right 942674602 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
942674595_942674602 9 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674602 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
942674589_942674602 25 Left 942674589 2:178413653-178413675 CCTCTCCTCCGCGCCGCCGTCTT No data
Right 942674602 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
942674591_942674602 17 Left 942674591 2:178413661-178413683 CCGCGCCGCCGTCTTCGTTGCTC No data
Right 942674602 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
942674588_942674602 29 Left 942674588 2:178413649-178413671 CCATCCTCTCCTCCGCGCCGCCG No data
Right 942674602 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
942674590_942674602 20 Left 942674590 2:178413658-178413680 CCTCCGCGCCGCCGTCTTCGTTG No data
Right 942674602 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942674602 Original CRISPR CCGCTCCCTCTGAATTCGCC GGG Intergenic
No off target data available for this crispr