ID: 942674607

View in Genome Browser
Species Human (GRCh38)
Location 2:178413719-178413741
Sequence CGGGCGGCTGTATCCCTGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942674607_942674614 -2 Left 942674607 2:178413719-178413741 CCGGGCAGGGATACAGCCGCCCG No data
Right 942674614 2:178413740-178413762 CGGGGCCTCTTGCTCGTGCTTGG No data
942674607_942674618 24 Left 942674607 2:178413719-178413741 CCGGGCAGGGATACAGCCGCCCG No data
Right 942674618 2:178413766-178413788 TCCGGACCTTGCTTCCTAAAGGG No data
942674607_942674617 23 Left 942674607 2:178413719-178413741 CCGGGCAGGGATACAGCCGCCCG No data
Right 942674617 2:178413765-178413787 TTCCGGACCTTGCTTCCTAAAGG No data
942674607_942674616 6 Left 942674607 2:178413719-178413741 CCGGGCAGGGATACAGCCGCCCG No data
Right 942674616 2:178413748-178413770 CTTGCTCGTGCTTGGTTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942674607 Original CRISPR CGGGCGGCTGTATCCCTGCC CGG (reversed) Intergenic
No off target data available for this crispr