ID: 942674610

View in Genome Browser
Species Human (GRCh38)
Location 2:178413722-178413744
Sequence GGCAGGGATACAGCCGCCCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942674598_942674610 7 Left 942674598 2:178413692-178413714 CCGCGGCGCCCGCTCCCTCTGAA No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data
942674601_942674610 -2 Left 942674601 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data
942674604_942674610 -7 Left 942674604 2:178413706-178413728 CCCTCTGAATTCGCCGGGCAGGG No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data
942674599_942674610 -1 Left 942674599 2:178413700-178413722 CCCGCTCCCTCTGAATTCGCCGG No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data
942674595_942674610 30 Left 942674595 2:178413669-178413691 CCGTCTTCGTTGCTCTTGGGTGG No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data
942674606_942674610 -8 Left 942674606 2:178413707-178413729 CCTCTGAATTCGCCGGGCAGGGA No data
Right 942674610 2:178413722-178413744 GGCAGGGATACAGCCGCCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942674610 Original CRISPR GGCAGGGATACAGCCGCCCG GGG Intergenic
No off target data available for this crispr