ID: 942674616

View in Genome Browser
Species Human (GRCh38)
Location 2:178413748-178413770
Sequence CTTGCTCGTGCTTGGTTTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942674599_942674616 25 Left 942674599 2:178413700-178413722 CCCGCTCCCTCTGAATTCGCCGG No data
Right 942674616 2:178413748-178413770 CTTGCTCGTGCTTGGTTTTCCGG No data
942674611_942674616 -10 Left 942674611 2:178413735-178413757 CCGCCCGGGGCCTCTTGCTCGTG No data
Right 942674616 2:178413748-178413770 CTTGCTCGTGCTTGGTTTTCCGG No data
942674607_942674616 6 Left 942674607 2:178413719-178413741 CCGGGCAGGGATACAGCCGCCCG No data
Right 942674616 2:178413748-178413770 CTTGCTCGTGCTTGGTTTTCCGG No data
942674604_942674616 19 Left 942674604 2:178413706-178413728 CCCTCTGAATTCGCCGGGCAGGG No data
Right 942674616 2:178413748-178413770 CTTGCTCGTGCTTGGTTTTCCGG No data
942674601_942674616 24 Left 942674601 2:178413701-178413723 CCGCTCCCTCTGAATTCGCCGGG No data
Right 942674616 2:178413748-178413770 CTTGCTCGTGCTTGGTTTTCCGG No data
942674606_942674616 18 Left 942674606 2:178413707-178413729 CCTCTGAATTCGCCGGGCAGGGA No data
Right 942674616 2:178413748-178413770 CTTGCTCGTGCTTGGTTTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942674616 Original CRISPR CTTGCTCGTGCTTGGTTTTC CGG Intergenic
No off target data available for this crispr