ID: 942675970

View in Genome Browser
Species Human (GRCh38)
Location 2:178427302-178427324
Sequence CAATTTTTAAAGCTTCCACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942675965_942675970 25 Left 942675965 2:178427254-178427276 CCCTGAAATATTATTTTTTGATT No data
Right 942675970 2:178427302-178427324 CAATTTTTAAAGCTTCCACCTGG No data
942675966_942675970 24 Left 942675966 2:178427255-178427277 CCTGAAATATTATTTTTTGATTT No data
Right 942675970 2:178427302-178427324 CAATTTTTAAAGCTTCCACCTGG No data
942675964_942675970 30 Left 942675964 2:178427249-178427271 CCATTCCCTGAAATATTATTTTT No data
Right 942675970 2:178427302-178427324 CAATTTTTAAAGCTTCCACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942675970 Original CRISPR CAATTTTTAAAGCTTCCACC TGG Intergenic
No off target data available for this crispr