ID: 942678841

View in Genome Browser
Species Human (GRCh38)
Location 2:178455512-178455534
Sequence CATGCCTGCCCCAAGCCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942678841_942678857 26 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678857 2:178455561-178455583 GGGCATCAGGAGAAAGGCTGGGG No data
942678841_942678856 25 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678856 2:178455560-178455582 AGGGCATCAGGAGAAAGGCTGGG No data
942678841_942678852 20 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG No data
942678841_942678851 13 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678851 2:178455548-178455570 CACACAGGTCCCAGGGCATCAGG No data
942678841_942678845 -10 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678845 2:178455525-178455547 GGCAGGCATGGGACTGGCCCAGG No data
942678841_942678846 -2 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678846 2:178455533-178455555 TGGGACTGGCCCAGGCACACAGG No data
942678841_942678848 6 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678848 2:178455541-178455563 GCCCAGGCACACAGGTCCCAGGG No data
942678841_942678855 24 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678855 2:178455559-178455581 CAGGGCATCAGGAGAAAGGCTGG No data
942678841_942678847 5 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678847 2:178455540-178455562 GGCCCAGGCACACAGGTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942678841 Original CRISPR CATGCCTGCCCCAAGCCCTG AGG (reversed) Intronic
No off target data available for this crispr