ID: 942678849

View in Genome Browser
Species Human (GRCh38)
Location 2:178455542-178455564
Sequence GCCCTGGGACCTGTGTGCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942678849_942678852 -10 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG No data
942678849_942678859 2 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678859 2:178455567-178455589 CAGGAGAAAGGCTGGGGCTTGGG No data
942678849_942678856 -5 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678856 2:178455560-178455582 AGGGCATCAGGAGAAAGGCTGGG No data
942678849_942678857 -4 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678857 2:178455561-178455583 GGGCATCAGGAGAAAGGCTGGGG No data
942678849_942678860 3 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678860 2:178455568-178455590 AGGAGAAAGGCTGGGGCTTGGGG No data
942678849_942678858 1 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678858 2:178455566-178455588 TCAGGAGAAAGGCTGGGGCTTGG No data
942678849_942678855 -6 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678855 2:178455559-178455581 CAGGGCATCAGGAGAAAGGCTGG No data
942678849_942678861 22 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678861 2:178455587-178455609 GGGGTCTTGTCCTCCCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942678849 Original CRISPR GCCCTGGGACCTGTGTGCCT GGG (reversed) Intronic
No off target data available for this crispr