ID: 942678852

View in Genome Browser
Species Human (GRCh38)
Location 2:178455555-178455577
Sequence GTCCCAGGGCATCAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942678841_942678852 20 Left 942678841 2:178455512-178455534 CCTCAGGGCTTGGGGCAGGCATG No data
Right 942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG No data
942678849_942678852 -10 Left 942678849 2:178455542-178455564 CCCAGGCACACAGGTCCCAGGGC No data
Right 942678852 2:178455555-178455577 GTCCCAGGGCATCAGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942678852 Original CRISPR GTCCCAGGGCATCAGGAGAA AGG Intronic
No off target data available for this crispr