ID: 942682633

View in Genome Browser
Species Human (GRCh38)
Location 2:178494144-178494166
Sequence TCTTCTCGATTGTGTCTGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 321
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 285}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942682632_942682633 8 Left 942682632 2:178494113-178494135 CCTACTGTATACTATCTGGAAAT 0: 1
1: 0
2: 2
3: 19
4: 231
Right 942682633 2:178494144-178494166 TCTTCTCGATTGTGTCTGTGTGG 0: 1
1: 0
2: 2
3: 33
4: 285

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942682633 Original CRISPR TCTTCTCGATTGTGTCTGTG TGG Intronic
900179944 1:1306672-1306694 TGTGCTTGATTGTGTATGTGTGG - Intronic
900730092 1:4252557-4252579 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
904932459 1:34100348-34100370 TCTCCCAGAATGTGTCTGTGTGG - Intronic
908038980 1:60086921-60086943 TGTTCTCCAGTGTGTCTGTGAGG + Intergenic
908968170 1:69791879-69791901 TCTTCTCAATTGTTTCTGAATGG - Intronic
909582301 1:77251406-77251428 TATTCTTGATTCTGTCAGTGTGG - Intergenic
909669166 1:78168819-78168841 TCTTCTCCATGGTGTCTGGATGG + Intergenic
909801748 1:79818743-79818765 TCTCCTCTATTGTGTGTGTAGGG + Intergenic
910123666 1:83817644-83817666 TCTTCTCTCTTTTGTCTATGTGG + Intergenic
910171667 1:84384622-84384644 TGTTCTTGATGGTGTCTGTAGGG + Intronic
910611579 1:89149390-89149412 GCTCCTGGAGTGTGTCTGTGGGG + Exonic
911032130 1:93500430-93500452 TCTTCTCTATTGTACCTTTGGGG + Intronic
911343692 1:96671769-96671791 TAATCTTGAGTGTGTCTGTGTGG + Intergenic
911403661 1:97408654-97408676 TGTTCCTAATTGTGTCTGTGAGG + Intronic
913062236 1:115219190-115219212 TCTTCTCCATTTTGTGGGTGAGG - Intergenic
914830997 1:151170797-151170819 TCCTCTTCATTGTCTCTGTGAGG - Intronic
916944382 1:169711286-169711308 TCTTCTTGACTTTGTCTCTGGGG - Intronic
917542369 1:175926765-175926787 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
917599587 1:176560765-176560787 TCTTCTCTTTTGTGTATGTTGGG - Intronic
919091508 1:192983158-192983180 TCTTCTAGATCAAGTCTGTGGGG + Intergenic
919282109 1:195503680-195503702 TCTTATCGTTTGTGTGTGTGTGG + Intergenic
920367368 1:205455268-205455290 TCCTAGCCATTGTGTCTGTGGGG - Intronic
921775504 1:219095473-219095495 TCTTCTCTATTGTGTTTGTGTGG - Intergenic
921978263 1:221226836-221226858 TGTTCTTGGGTGTGTCTGTGAGG + Intergenic
923864476 1:237924431-237924453 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
1064128143 10:12682275-12682297 TCTTCTGGAAAGTGTCTTTGTGG + Intronic
1065779795 10:29156707-29156729 TCTTATAGATTGTGGCTGAGTGG - Intergenic
1066752145 10:38668863-38668885 TGTTCCCGGTTGTGTCTGTGAGG - Intergenic
1066964888 10:42254190-42254212 TGTTCCCGGTTGTTTCTGTGAGG + Intergenic
1068150317 10:53122850-53122872 TGTTCTAGGTTGTGTGTGTGTGG + Intergenic
1069630350 10:69893805-69893827 TCTTCAGGTATGTGTCTGTGAGG - Intronic
1069791333 10:71024017-71024039 TCATCTTGGGTGTGTCTGTGAGG - Intergenic
1073704164 10:105963403-105963425 TCTTCTTGCTTGTGTCTTTTAGG + Intergenic
1074046496 10:109844346-109844368 TCTTGTCCATTCTGTCTCTGTGG - Intergenic
1075306778 10:121374942-121374964 CCTTCTCCCCTGTGTCTGTGTGG - Intergenic
1075967760 10:126627469-126627491 ACGTCTTGATTGTCTCTGTGGGG + Intronic
1076275233 10:129192895-129192917 GCTTCTGCATTTTGTCTGTGTGG - Intergenic
1076276185 10:129200641-129200663 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1076501422 10:130939375-130939397 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1076813782 10:132903966-132903988 TATTCTCAATTGTGACTGTGTGG - Intronic
1077951181 11:6959022-6959044 TGTTCCCGAGTGTGACTGTGAGG - Intronic
1079488197 11:20957943-20957965 TTTTCTCTATTTTGTCTTTGTGG - Intronic
1079506446 11:21157922-21157944 TGTTCCTGAGTGTGTCTGTGAGG + Intronic
1079637550 11:22763235-22763257 TCTTCAGGATTATGCCTGTGTGG + Intronic
1079762079 11:24341460-24341482 TGTTCCCGGGTGTGTCTGTGAGG - Intergenic
1080558161 11:33436535-33436557 TCTTCCTGAGTGTGTCTGTGCGG - Intergenic
1081291018 11:41326037-41326059 TGTTCTTGGGTGTGTCTGTGAGG + Intronic
1082679774 11:56153167-56153189 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1082919705 11:58479765-58479787 TGTTCCTGAATGTGTCTGTGAGG - Intergenic
1085847948 11:80087217-80087239 TCTTCTTGATGATGTCTGAGTGG - Intergenic
1086763291 11:90660936-90660958 TTTTCCTGGTTGTGTCTGTGAGG - Intergenic
1086775373 11:90824761-90824783 TGTTCTGTCTTGTGTCTGTGGGG + Intergenic
1087048561 11:93864802-93864824 TCTTCTAGTTTTTGTCTGAGAGG - Intergenic
1087415523 11:97850797-97850819 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1088205778 11:107390804-107390826 TCTTCCTGGGTGTGTCTGTGAGG + Intronic
1088365317 11:109034284-109034306 TCTTCTCTGTTATGTGTGTGTGG + Intergenic
1090196973 11:124824909-124824931 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
1093292307 12:17342816-17342838 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
1093687584 12:22074506-22074528 CCTTGTTGATTGTGTCTTTGTGG - Intronic
1094007166 12:25767216-25767238 TCATCTATATTGTGTGTGTGTGG + Intergenic
1094403278 12:30085772-30085794 TGTTCCTGGTTGTGTCTGTGAGG - Intergenic
1094525002 12:31225637-31225659 GCTTCTCGAGTCTATCTGTGCGG + Intergenic
1095083454 12:38033064-38033086 TCTTCTCGAGGGTATCTTTGTGG - Intergenic
1097100089 12:56581656-56581678 TGTTCTCGAGTGTGGCTTTGCGG + Intronic
1097431954 12:59519914-59519936 TGATCCCGAGTGTGTCTGTGAGG - Intergenic
1099632445 12:85167711-85167733 TGTTCCTGGTTGTGTCTGTGAGG - Intronic
1100991116 12:100252024-100252046 TCTTCTCTTTTGTGGGTGTGGGG + Intronic
1104365492 12:128172913-128172935 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1104366377 12:128181527-128181549 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1105635528 13:22212110-22212132 ACGTTTCCATTGTGTCTGTGTGG + Intergenic
1106380972 13:29238731-29238753 TGTTCCTGAGTGTGTCTGTGAGG - Intronic
1108876048 13:55052263-55052285 TCTTCCTGGGTGTGTCTGTGAGG - Intergenic
1108903763 13:55445634-55445656 TATTCTGGGGTGTGTCTGTGAGG - Intergenic
1109155361 13:58902849-58902871 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1110750559 13:79110233-79110255 TGATCCCGAGTGTGTCTGTGAGG + Intergenic
1112183494 13:97107332-97107354 TGTTCCCGAGTGTGTCTGTGAGG - Intergenic
1112863497 13:103864666-103864688 TGTTCTTGGGTGTGTCTGTGAGG + Intergenic
1113218716 13:108073111-108073133 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
1115087982 14:29539919-29539941 TGTTCTAGATTGTGCCTTTGAGG + Intergenic
1115656440 14:35447905-35447927 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1116122715 14:40741178-40741200 TGTTCTCGGGTGTGTCTGTGAGG - Intergenic
1116291892 14:43053744-43053766 TGTTCCTGGTTGTGTCTGTGAGG - Intergenic
1116333046 14:43618950-43618972 TCTTCCTGGGTGTGTCTGTGAGG - Intergenic
1116774582 14:49165536-49165558 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
1118846563 14:69551774-69551796 TCTTCAAGGTTGTGGCTGTGAGG + Intergenic
1118917321 14:70118514-70118536 TATTCTCCCTTGTTTCTGTGGGG + Intronic
1119428916 14:74553033-74553055 TCTTCTTGATTTTCTCCGTGAGG + Exonic
1119676725 14:76561322-76561344 TGTTCTTGGGTGTGTCTGTGAGG + Intergenic
1120568415 14:86087788-86087810 TCTTTTCCATTGTCTCTGTTTGG - Intergenic
1120622152 14:86776977-86776999 TATTCTGGATTGTGTCTTTCAGG - Intergenic
1121897939 14:97665892-97665914 TCTTCTTAGGTGTGTCTGTGAGG + Intergenic
1123184572 14:106504665-106504687 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1124413834 15:29458370-29458392 TATTCCTGATAGTGTCTGTGAGG - Intronic
1124637071 15:31372086-31372108 TCTTCTCGCCCGTGTGTGTGCGG - Exonic
1125321453 15:38493569-38493591 TCTTTTCCATTGTCTCTGTTAGG + Intronic
1125423809 15:39530251-39530273 TGTTCTTAAGTGTGTCTGTGAGG - Intergenic
1127283021 15:57508199-57508221 TCTTTTTGTTTGTGTGTGTGTGG - Intronic
1127326178 15:57897165-57897187 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
1130387243 15:83422618-83422640 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1131973322 15:97914777-97914799 TCTTCTCCATCTTTTCTGTGAGG - Intergenic
1132054961 15:98644012-98644034 TCTTGTTGCTTGTGGCTGTGTGG + Intergenic
1133051554 16:3120061-3120083 GCTTCTCGCCTGTGTGTGTGCGG - Exonic
1133224696 16:4335296-4335318 GCTTCTCGTTGGTGTGTGTGCGG - Exonic
1134205513 16:12234523-12234545 TTTTCTCGATGGTGTCCTTGAGG + Intronic
1136730576 16:32408177-32408199 TGTTCCCGGTTGTGTCTGTGAGG + Intergenic
1138789838 16:59890559-59890581 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1138970978 16:62142201-62142223 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
1139210522 16:65072313-65072335 CTTTCTTGCTTGTGTCTGTGTGG - Intronic
1139243251 16:65415996-65416018 CCTTCTCAAGTATGTCTGTGGGG + Intergenic
1202995825 16_KI270728v1_random:109138-109160 TGTTCCCGGTTGTGTCTGTGAGG - Intergenic
1203022512 16_KI270728v1_random:421480-421502 TGTTCCCGGTTGTGTCTGTGAGG - Intergenic
1142740086 17:1926842-1926864 ACTTCTCAGTTGTGTCTGGGAGG + Intergenic
1143614740 17:8043016-8043038 TATTCTCTTTTGTCTCTGTGGGG - Intronic
1148291703 17:46457495-46457517 ACATTTCGGTTGTGTCTGTGAGG + Intergenic
1148313893 17:46675202-46675224 ACATTTCGGTTGTGTCTGTGAGG + Intronic
1148653526 17:49266678-49266700 GCTTCTTGATTATGTGTGTGTGG + Intergenic
1149644700 17:58231842-58231864 TCTTCCCAATTGAGTCTGTTAGG + Intronic
1151660878 17:75517232-75517254 TCTTCTGGAGTGTGTAAGTGGGG + Exonic
1153871749 18:9327611-9327633 TCTTATCGTTTGTGTCTTTATGG - Intergenic
1154263534 18:12859429-12859451 TCTTCCCCATTATATCTGTGAGG + Intronic
1156608480 18:38697813-38697835 TCTTGTTCATTGTGTCAGTGAGG + Intergenic
1156849083 18:41704874-41704896 TCTTCTCTCATGTGCCTGTGTGG + Intergenic
1157786558 18:50488796-50488818 TGTTCTTGGGTGTGTCTGTGAGG + Intergenic
1157956012 18:52098515-52098537 TCTTCTAGAATTTGTCTTTGTGG + Intergenic
1157956796 18:52107429-52107451 TCTTCCTGGGTGTGTCTGTGAGG - Intergenic
1158129397 18:54136171-54136193 ACCTCTCAATTCTGTCTGTGTGG - Intergenic
1158175881 18:54655097-54655119 TGTTCCTGAATGTGTCTGTGAGG - Intergenic
1158323245 18:56286682-56286704 TCTTCAGGATTGTGTCTTTCGGG + Intergenic
1159200751 18:65180692-65180714 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1159608794 18:70503509-70503531 TCTTCTCTGTTGTCTCTGTTGGG + Intergenic
1159613249 18:70549657-70549679 TGGTCTGGAGTGTGTCTGTGAGG + Intergenic
1159661380 18:71099680-71099702 TGTTCTGGATTGTGTCTTTTGGG + Intergenic
1159756902 18:72376843-72376865 TGTTCTCGGGTGTGTCTGTGAGG - Intergenic
1160092750 18:75842435-75842457 TGTTCCTGGTTGTGTCTGTGAGG + Intergenic
1160433674 18:78829980-78830002 TGTTCACGAGTGGGTCTGTGGGG - Intergenic
1162193144 19:8962886-8962908 TCCTCTCCAATGTGTCTGTGGGG - Exonic
1163134974 19:15303790-15303812 ACTTCTCGACTGTTTCTGTCAGG + Intronic
1168252853 19:55150154-55150176 TCTCAGCGTTTGTGTCTGTGGGG + Intergenic
925245886 2:2382608-2382630 TGTTCTTGGTTGTCTCTGTGAGG + Intergenic
925851137 2:8083396-8083418 GCTCCACGATTGTGTGTGTGAGG + Intergenic
928696150 2:33852178-33852200 TCTTCTTGATACTGTCTGGGTGG + Intergenic
930395866 2:50823989-50824011 TCTTGTTCATTGTGTGTGTGAGG - Intronic
930491896 2:52084367-52084389 TTTTCTCGTGTGTGTGTGTGTGG + Intergenic
931030889 2:58173289-58173311 TCTTCTCGAGAGTATCTTTGTGG - Intronic
931048651 2:58386029-58386051 TCTTCTCGAGAGTATCTTTGTGG + Intergenic
931486101 2:62693885-62693907 TTTTCTTGATGGTGTCTTTGAGG + Intronic
932870945 2:75397094-75397116 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
933078352 2:77956952-77956974 TTTTCTTGGGTGTGTCTGTGAGG - Intergenic
934315139 2:91911005-91911027 TGTTCCCGGTTGTGTCTGTGAGG - Intergenic
937620287 2:123977283-123977305 TGTTCCCGGGTGTGTCTGTGAGG - Intergenic
940861026 2:158770985-158771007 TATTTCCGAGTGTGTCTGTGAGG - Intergenic
941081066 2:161061262-161061284 TGTTCCTCATTGTGTCTGTGAGG + Intergenic
941327880 2:164140458-164140480 TCTTCTGAAGTGTGTGTGTGGGG + Intergenic
941356083 2:164493892-164493914 TCTTCTGCTGTGTGTCTGTGTGG - Intronic
941722377 2:168825531-168825553 TGTGCTCTATTGTGTGTGTGTGG + Intronic
942220168 2:173761363-173761385 ACCTCTCGATTGTGCCTTTGAGG - Intergenic
942249288 2:174033996-174034018 TCTCCTTCATTGTGTCTTTGGGG - Intergenic
942682633 2:178494144-178494166 TCTTCTCGATTGTGTCTGTGTGG + Intronic
943301741 2:186211295-186211317 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
943587922 2:189762457-189762479 TCCTCTAGGTTGTGTCTGTCTGG - Intronic
946345275 2:219104705-219104727 TCTTCTTTTTTGTGTGTGTGGGG - Intronic
1169808362 20:9582670-9582692 TCTTCTTGGGTGTGTGTGTGTGG + Intronic
1170272836 20:14547765-14547787 TCTCCTCGATTGTGTACCTGAGG + Intronic
1174061890 20:47838906-47838928 GCTCCTTGATTGTGTCTGTGTGG - Intergenic
1174069617 20:47890329-47890351 GCTTCTTGATTGTGTCTGTGTGG + Intergenic
1175250230 20:57604738-57604760 ACTTCTGGATTGTGTGTCTGCGG + Exonic
1175952690 20:62591868-62591890 TGTTCACGGTTGTGTGTGTGTGG + Intergenic
1176334798 21:5586310-5586332 TCTGCTCCACTGTGTCTGTGAGG + Intergenic
1176392959 21:6234638-6234660 TCTGCTCCACTGTGTCTGTGAGG - Intergenic
1176468460 21:7081536-7081558 TCTGCTCCACTGTGTCTGTGAGG + Intronic
1176492021 21:7463314-7463336 TCTGCTCCACTGTGTCTGTGAGG + Intergenic
1176508621 21:7675069-7675091 TCTGCTCCACTGTGTCTGTGAGG - Intergenic
1177027579 21:15938515-15938537 TCTTCCTGGGTGTGTCTGTGAGG - Intergenic
1177395968 21:20536627-20536649 TGTTCCTGAGTGTGTCTGTGGGG - Intergenic
1177913486 21:27058630-27058652 TCATCTTGGGTGTGTCTGTGAGG + Intergenic
1177927965 21:27242548-27242570 TCTTCTGGGGTCTGTCTGTGAGG + Intergenic
1178011517 21:28291571-28291593 TGTTCCCGAGTGTGTCTGTGAGG - Intergenic
1178672608 21:34605074-34605096 TGTTCCTGAATGTGTCTGTGAGG + Intronic
1180241542 21:46510384-46510406 TCTTCCTGGGTGTGTCTGTGAGG - Intronic
1180541899 22:16456889-16456911 TGTTCCCGGTTGTGTCTGTGAGG - Intergenic
1181185694 22:21102133-21102155 TCCTCTAGTGTGTGTCTGTGGGG + Intergenic
1183569487 22:38641658-38641680 GCTTCTCGATGGTGGCTATGAGG - Intronic
1183705984 22:39475222-39475244 TCTTCTTGATTGTGTTTTTTGGG + Intronic
951174327 3:19581355-19581377 TATTTTCTGTTGTGTCTGTGAGG - Intergenic
951800194 3:26587207-26587229 CCTTCTCCCTTGTGCCTGTGAGG + Intergenic
955140863 3:56267982-56268004 CTTTCTTGATTGTGTCTGTGTGG - Intronic
956932038 3:74054477-74054499 TCATGTCTATTGTGTCTGTCTGG + Intergenic
958060115 3:88468699-88468721 TGTTCCTGGTTGTGTCTGTGAGG + Intergenic
959868792 3:111302890-111302912 TGTTCCCGGGTGTGTCTGTGAGG - Intronic
961030688 3:123600993-123601015 TCTTCCTGGGTGTGTCTGTGAGG + Intergenic
963615985 3:147538907-147538929 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
963929205 3:150984700-150984722 TATTCCTGAGTGTGTCTGTGAGG + Intergenic
964629509 3:158794883-158794905 TATTCTCTTTTCTGTCTGTGTGG + Intronic
965219794 3:165914166-165914188 TATTCTTGGGTGTGTCTGTGAGG - Intergenic
965652036 3:170944265-170944287 TGTTCCCGGGTGTGTCTGTGAGG - Intergenic
966332267 3:178827338-178827360 TCTTTTCCATTGTGTTTGTGGGG + Intronic
966658840 3:182391390-182391412 CCTTTTCAATTGTGTCAGTGGGG - Intergenic
969283113 4:6184787-6184809 TGTTCCTGAGTGTGTCTGTGAGG + Intronic
970629645 4:17926224-17926246 TGTTCTTGAGTGTGTCTGTGAGG + Intronic
970717305 4:18941339-18941361 TGTTCCCGGGTGTGTCTGTGAGG + Intergenic
971043093 4:22776903-22776925 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
971705185 4:30032530-30032552 TCATCTTGATTGTTTCTGTATGG + Intergenic
971923026 4:32968818-32968840 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
972096824 4:35358283-35358305 TTTGCTCCAATGTGTCTGTGGGG - Intergenic
972241338 4:37196194-37196216 TATTCAGGATTGTGTCTTTGGGG - Intergenic
973092550 4:46156664-46156686 TGATCCTGATTGTGTCTGTGAGG + Intergenic
973120721 4:46518510-46518532 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
974193478 4:58538632-58538654 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
976030679 4:80749872-80749894 TGTTCTTGGGTGTGTCTGTGAGG - Intronic
976520871 4:86024656-86024678 TCTTCTAGATAGGTTCTGTGAGG + Intronic
976805401 4:89040775-89040797 TGTTCCTGAGTGTGTCTGTGGGG + Intronic
977205264 4:94158735-94158757 TGTTCTTGGGTGTGTCTGTGTGG - Intergenic
977721958 4:100249463-100249485 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
977762551 4:100756769-100756791 TGTTCTTGGGTGTGTCTGTGAGG - Intronic
977947380 4:102929095-102929117 TGTTCCCGGTTGTGTCTGTGAGG - Intronic
978255371 4:106686283-106686305 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
978602097 4:110439466-110439488 TCTTCCTGGGTGTGTCTGTGAGG - Intronic
979342527 4:119543508-119543530 TCTTCTCAATTTATTCTGTGAGG + Intronic
980008018 4:127563189-127563211 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
980807797 4:137836190-137836212 TGTTCTGGGGTGTGTCTGTGAGG + Intergenic
980854704 4:138425191-138425213 TGTTCCTGGTTGTGTCTGTGAGG + Intergenic
981844324 4:149150280-149150302 TCTTCTGGATATTGTCTGTCTGG - Intergenic
981936709 4:150247189-150247211 TTTTCTTGAGTGTGTGTGTGTGG + Intronic
982123733 4:152166362-152166384 TCTTCTGGGGTGTGTGTGTGAGG - Intergenic
982530958 4:156542958-156542980 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
982606414 4:157521867-157521889 TGTACCCGAGTGTGTCTGTGAGG - Intergenic
982656117 4:158151855-158151877 TGTTCCTGAGTGTGTCTGTGAGG + Intronic
982839309 4:160161938-160161960 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
982894553 4:160902440-160902462 TCTTCCTGGGTGTGTCTGTGAGG + Intergenic
983020054 4:162665232-162665254 TGTTCTTGAGTGTGTCTGTGAGG + Intergenic
984347052 4:178541993-178542015 TCTTCCCGGGTGTATCTGTGAGG + Intergenic
984828254 4:183947734-183947756 TCTTCTCTGTTGTGTTTGTCAGG + Intronic
984969016 4:185169773-185169795 TCGTCTTGATTCTGCCTGTGTGG - Intronic
985370601 4:189281941-189281963 TGTTCTTGCGTGTGTCTGTGAGG + Intergenic
987153931 5:15068840-15068862 TATTCCTGGTTGTGTCTGTGAGG - Intergenic
988228296 5:28443052-28443074 TATTTTTGAGTGTGTCTGTGAGG - Intergenic
988366384 5:30305693-30305715 TCTTCCTGAGTGTGGCTGTGAGG + Intergenic
989200953 5:38763317-38763339 TTTTCCTGAGTGTGTCTGTGAGG + Intergenic
989985721 5:50695105-50695127 TGTTCTTGGGTGTGTCTGTGAGG - Intronic
990807418 5:59681341-59681363 TCTTCGTGCTTGTTTCTGTGTGG - Intronic
990942187 5:61213951-61213973 TTTTCTTTATTGTATCTGTGAGG + Intergenic
992353791 5:75958319-75958341 TATTTTCGGTTCTGTCTGTGAGG + Intergenic
993760681 5:91793125-91793147 TCTTTCCGGGTGTGTCTGTGAGG + Intergenic
994855838 5:105118078-105118100 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
996511284 5:124318940-124318962 TATTCCTGAATGTGTCTGTGAGG - Intergenic
998327430 5:141293991-141294013 ACTTCTGAATTGTGTCTATGTGG - Intergenic
998704415 5:144742442-144742464 TCTTCTCCATTAGGTTTGTGAGG + Intergenic
1004335724 6:14762706-14762728 TCTTCTGTCCTGTGTCTGTGGGG - Intergenic
1004518954 6:16344347-16344369 TATTCTTGGTTGTGTCTGTGAGG + Intronic
1006371960 6:33650321-33650343 TCTTCTGGCATGTGTATGTGTGG + Intronic
1011781016 6:90789383-90789405 TATTCCCAAGTGTGTCTGTGAGG - Intergenic
1012417755 6:99027986-99028008 TCTTCAGGATTGTGAGTGTGAGG - Intergenic
1013004951 6:106063833-106063855 TCATCTTCATTGTGTCAGTGTGG + Intergenic
1014334776 6:120119848-120119870 TGTTCTTGGGTGTGTCTGTGAGG + Intergenic
1014581005 6:123137337-123137359 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1014629089 6:123767287-123767309 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1015657839 6:135539969-135539991 TGTTCCCGGGTGTGTCTGTGAGG - Intergenic
1017330506 6:153193077-153193099 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1018105330 6:160480767-160480789 TATTTTCCTTTGTGTCTGTGAGG + Intergenic
1018122846 6:160654438-160654460 TAATCTCGGTTATGTCTGTGAGG - Intronic
1018780998 6:167065211-167065233 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1022780193 7:33574022-33574044 ACTTCTCCATTGTGCATGTGGGG + Intronic
1024329631 7:48143131-48143153 TCTTCTCTTTTGTGTTTATGGGG + Intergenic
1024563658 7:50664455-50664477 TCCTCTGCAGTGTGTCTGTGGGG + Intronic
1024585006 7:50834518-50834540 ACTTCTCCATTGTGTCTGAATGG - Intergenic
1025232561 7:57212258-57212280 ACTCCTTGATTGTGTCTGTGTGG + Intergenic
1025622009 7:63181961-63181983 TGTTCCCGGGTGTGTCTGTGAGG - Intergenic
1026046580 7:66909714-66909736 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1032672352 7:134096881-134096903 TGTTCCTGGTTGTGTCTGTGAGG - Intergenic
1034646757 7:152654268-152654290 TTTTCTCTATTATTTCTGTGTGG - Intronic
1034896368 7:154878805-154878827 TCTTCACGATTGTTTCTTTTGGG + Intronic
1039280043 8:35974587-35974609 TGTTCTTGGTTGTGTCTGTGAGG - Intergenic
1039280067 8:35974828-35974850 TGTTCTTGGTTGTGTCTGTGAGG - Intergenic
1042060279 8:64809226-64809248 TCATCTCAATTGTGTCTATTAGG + Intergenic
1042855263 8:73260794-73260816 TTTTCCTGAGTGTGTCTGTGAGG + Intergenic
1042888928 8:73585723-73585745 ATTTCTCGTTTGTGTCTGAGGGG - Intronic
1043742279 8:83828820-83828842 TGTTCCTGAGTGTGTCTGTGAGG - Intergenic
1044435173 8:92153560-92153582 TATTCTTGGGTGTGTCTGTGAGG + Intergenic
1047550946 8:125871639-125871661 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1047722416 8:127653404-127653426 TGATCCTGATTGTGTCTGTGAGG + Intergenic
1047731287 8:127730906-127730928 TCTTCCCTTTTGTGTCTCTGGGG + Intergenic
1048193185 8:132308955-132308977 TGTTCCTGGTTGTGTCTGTGAGG + Intronic
1048463277 8:134640413-134640435 TGTGCTCCATTGAGTCTGTGTGG - Intronic
1048601410 8:135922590-135922612 TGTTCTTGGGTGTGTCTGTGAGG + Intergenic
1048841576 8:138571449-138571471 TCTTCCTGGGTGTGTCTGTGAGG + Intergenic
1049469222 8:142768062-142768084 GCTGCTCGATGGTGACTGTGAGG + Intronic
1049599852 8:143502498-143502520 TATTTTAGTTTGTGTCTGTGCGG - Intronic
1050771454 9:9206488-9206510 TGTTCTTGAGTGTGTCTGTGAGG + Intronic
1050933423 9:11361131-11361153 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1051138078 9:13946740-13946762 TGTTCTTGAGTGTGTGTGTGTGG + Intergenic
1051668915 9:19491159-19491181 TCTTCTCCTTTGTGTGTGTGTGG + Intergenic
1051716625 9:19991482-19991504 TGTTCCCGGGTGTGTCTGTGAGG - Intergenic
1056556365 9:87693059-87693081 TTTTTTCGATTGTATCTGTTTGG + Intronic
1057534542 9:95886745-95886767 TGATCTAGGTTGTGTCTGTGAGG + Intronic
1057797151 9:98166142-98166164 TTTTCCTGATTGTATCTGTGTGG - Intronic
1058612038 9:106788106-106788128 TCTTCCTGGATGTGTCTGTGAGG - Intergenic
1203426843 Un_GL000195v1:48610-48632 TCTGCTCCACTGTGTCTGTAAGG - Intergenic
1185966565 X:4612479-4612501 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1185989325 X:4875534-4875556 TCTTCCTGGGTGTGTCTGTGAGG + Intergenic
1186153859 X:6705590-6705612 TGTTTTCGGGTGTGTCTGTGAGG - Intergenic
1187575756 X:20552880-20552902 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1187766203 X:22645007-22645029 TCTTACCGATTGTTTATGTGTGG - Intergenic
1188900277 X:35723680-35723702 TCTTTCTGAGTGTGTCTGTGAGG - Intergenic
1190498973 X:51056488-51056510 TCTTCTGGAGTGTGTCTGAAAGG + Intergenic
1190524656 X:51316763-51316785 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1192419414 X:71015606-71015628 TATTTTGGAGTGTGTCTGTGAGG - Intergenic
1192672937 X:73165772-73165794 TGATCTTGAATGTGTCTGTGAGG - Intergenic
1193121046 X:77823361-77823383 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1195235999 X:102898809-102898831 TAATCCCGGTTGTGTCTGTGTGG - Intergenic
1195723425 X:107889607-107889629 TCTTCTCGAGGGTATCTTTGTGG + Intronic
1196558271 X:117117241-117117263 TATTCTTGGGTGTGTCTGTGAGG - Intergenic
1196772300 X:119307314-119307336 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1197705149 X:129629668-129629690 TCCTCTCCCTTGTGTCTGTAAGG + Intergenic
1198012472 X:132572325-132572347 TGTTCTTGGGTGTGTCTGTGAGG - Intergenic
1199275579 X:145938642-145938664 TGTTCCCGGGTGTGTCTGTGAGG + Intergenic
1200017230 X:153175993-153176015 TCTTCTCCATTTTGTATGTAAGG - Intergenic
1200368646 X:155697127-155697149 TATTTTTGGTTGTGTCTGTGAGG + Intergenic
1201182810 Y:11365815-11365837 TTTTCCCGGTTGTGTCTGTGAGG - Intergenic
1201530052 Y:14981868-14981890 TGATCTTGAGTGTGTCTGTGAGG - Intergenic
1201714926 Y:17034046-17034068 TGTTCCTGAGTGTGTCTGTGAGG + Intergenic
1201716956 Y:17055573-17055595 TATTCCTGAGTGTGTCTGTGAGG + Intergenic