ID: 942683200

View in Genome Browser
Species Human (GRCh38)
Location 2:178501226-178501248
Sequence CTGTGGGGCTCTGTAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 423
Summary {0: 1, 1: 0, 2: 4, 3: 50, 4: 368}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942683200 Original CRISPR CTGTGGGGCTCTGTAATTTC TGG Intronic
900364922 1:2307424-2307446 CTGTGCGGCTCTGCACTTCCTGG - Exonic
906051727 1:42880190-42880212 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
906344514 1:45006795-45006817 CTGAGGGCATCTGTCATTTCAGG - Exonic
907614891 1:55913509-55913531 CTCTGGGGCTCTGTGGTTCCTGG + Intergenic
909907916 1:81221605-81221627 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
910259969 1:85284939-85284961 CTCTGGGGCTCTGTGGTTCCCGG + Intergenic
911288615 1:96028381-96028403 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
911497577 1:98650273-98650295 CTTTGAGGCTCTGCAGTTTCTGG - Intergenic
911935048 1:103959965-103959987 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
912044564 1:105437806-105437828 CTCTGGGGCTCTGCAGTTCCTGG + Intergenic
912094550 1:106121764-106121786 CTTTAGGGCTCTATAGTTTCTGG + Intergenic
918124707 1:181572871-181572893 CTGTGGCGCTTGGTAATTTGTGG + Intronic
918983589 1:191595527-191595549 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
919264090 1:195238345-195238367 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
919513338 1:198493591-198493613 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
920416296 1:205801081-205801103 CTTTGGGGCACTGAAATTCCTGG - Intronic
921097902 1:211902553-211902575 CTTTGGGGCCCTGTGATTCCTGG + Intergenic
922141596 1:222893697-222893719 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
923328248 1:232899289-232899311 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
923755379 1:236786455-236786477 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
924012876 1:239685203-239685225 CTGGGTGGCTCTATAATTTGAGG + Intronic
1063076214 10:2719341-2719363 TTGTGGGGCTCTGGCACTTCAGG - Intergenic
1063119465 10:3094580-3094602 GTGTGGGGCTGTTTAATCTCAGG + Intronic
1063696397 10:8339488-8339510 CTATGGGGCTCAGAAATTACGGG - Intergenic
1064010413 10:11730790-11730812 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1064529552 10:16293951-16293973 CTGTGTGCCTCTGATATTTCTGG + Intergenic
1064559297 10:16580136-16580158 CTGTGAGACTCTTGAATTTCTGG + Intergenic
1065201371 10:23316354-23316376 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1065806202 10:29395450-29395472 CTTTGGTGCTCTGTGGTTTCTGG + Intergenic
1066188962 10:33037707-33037729 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1067326472 10:45272464-45272486 CTGTGGGTGTCTGTTATTTATGG - Intergenic
1068083679 10:52348256-52348278 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
1068279801 10:54854239-54854261 CTTTGGGGCCCTGGAGTTTCTGG - Intronic
1068300377 10:55131343-55131365 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1068823147 10:61401672-61401694 CTGTGGGACTTTGTATTTGCGGG - Intergenic
1068919376 10:62466200-62466222 CTTTGGGGTTCTGTAGTTCCTGG + Intronic
1069121905 10:64577507-64577529 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1070201096 10:74207237-74207259 CTTTGGGGCTCTGTGGTTTCTGG - Intronic
1070401300 10:76055826-76055848 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1071053011 10:81473882-81473904 CTTTGGGTCTCTGTAGTTCCTGG + Intergenic
1071228188 10:83556401-83556423 TTGTTGGGCTCTGAAATTTTTGG - Intergenic
1071819259 10:89264026-89264048 CTTTGGGGCACTGTGGTTTCTGG - Intronic
1072704477 10:97670756-97670778 CTGTGTGTCTGTGTGATTTCAGG + Intronic
1072896435 10:99371353-99371375 CAGTGGGGCTGTGTACTTTCAGG - Intronic
1073167974 10:101474603-101474625 CTGTGGTTCTCTTTCATTTCTGG + Intronic
1075131993 10:119748303-119748325 CAGTGGGGCTCTGCAGTTCCTGG - Intronic
1076261884 10:129073220-129073242 CTGTGGTCATCTGGAATTTCTGG - Intergenic
1077755760 11:5025750-5025772 CTGTGGTGTGCTGTAAGTTCAGG - Intergenic
1078297302 11:10086090-10086112 CTGGTGTGCTCTGTCATTTCTGG + Intronic
1078874402 11:15378896-15378918 CTTTGGGGCTCTGTATTTCCTGG + Intergenic
1079503857 11:21132661-21132683 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1080578527 11:33622466-33622488 CTGTGGGGCTCTCTCATTCCTGG - Intronic
1081082170 11:38756176-38756198 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1081163841 11:39785228-39785250 CTTTGGGGCTGTGTAGTTCCTGG - Intergenic
1081767278 11:45620486-45620508 CTTAGGGGCTCTGTAGTTCCTGG - Intergenic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1083916190 11:65745075-65745097 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1084069511 11:66725186-66725208 CTGTGGGGGTCTGTGATCTAAGG - Intronic
1084740999 11:71139593-71139615 CTGGTGAGCTCTGTTATTTCTGG - Intronic
1085403839 11:76250120-76250142 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1086084670 11:82942722-82942744 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1086508213 11:87528098-87528120 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1086850321 11:91800156-91800178 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1087407788 11:97751828-97751850 CTTTGGGGGTCTGTGATTTGTGG - Intergenic
1087534317 11:99424651-99424673 CTTTGGGGCTCTGCCATTCCTGG - Intronic
1088319174 11:108537110-108537132 CTGAAGGGCTCTATAATCTCAGG - Intronic
1088328741 11:108628674-108628696 CTTTGGGGCTCTGTGCTTCCTGG - Intergenic
1088583468 11:111336830-111336852 CCCTGTGGCTCAGTAATTTCTGG - Intergenic
1090500562 11:127256894-127256916 ATGTGAGGATCTGTAAGTTCTGG + Intergenic
1092940949 12:13406478-13406500 ATCTGGAGCTCTGAAATTTCAGG - Intergenic
1093182952 12:15988098-15988120 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1093317134 12:17666169-17666191 CTTTGGGGCTCTGAAGTTTCTGG - Intergenic
1095443990 12:42267080-42267102 CTTTGGAGCTCTGTGGTTTCTGG - Intronic
1095603305 12:44038297-44038319 CTCTGGGGCTCTGCAGTTCCTGG + Intronic
1095644414 12:44526449-44526471 CTGTGTGGCTGTGTCATTTTGGG - Intronic
1095749606 12:45696405-45696427 CTTTGGGGCTCTGCAGTTCCAGG - Intergenic
1096295566 12:50381088-50381110 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1097078494 12:56412552-56412574 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1097360704 12:58655672-58655694 CTCTGGGGCTCTGCAGTTCCTGG - Intronic
1097500338 12:60393097-60393119 CTCTGGGGCTCTGCAGTTTCCGG + Intergenic
1097633772 12:62096905-62096927 GTGTGGAGCTGTGTGATTTCAGG - Intronic
1098519563 12:71420505-71420527 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1098576614 12:72049985-72050007 CTGTGGGGGTCAGTCATTCCAGG - Intronic
1098802901 12:74984973-74984995 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1099049678 12:77767729-77767751 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1099560886 12:84173376-84173398 CTTTGAGGCTCTGTGGTTTCTGG - Intergenic
1099683247 12:85855671-85855693 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1099738656 12:86601926-86601948 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1101580803 12:106039634-106039656 CTTCAGGGCTCTGTAGTTTCTGG - Intergenic
1102804123 12:115764349-115764371 CTGTGGGGTTCTGTGATTGGTGG - Intergenic
1103266040 12:119631121-119631143 CTGTCTTGCTGTGTAATTTCTGG + Intronic
1103728795 12:123012586-123012608 CTGTGGGGCTCTGCCCTTCCTGG + Intronic
1104738141 12:131152607-131152629 CTTTGTGGCTCTGTAGTTCCTGG + Intergenic
1105617389 13:22030939-22030961 CTGTGCTGGTCAGTAATTTCTGG + Intergenic
1105837739 13:24225424-24225446 CTTTGGGGCTCTGTGATTCCTGG - Intronic
1106253428 13:28001385-28001407 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1106978996 13:35255660-35255682 TTCTGGGGCTCTGTAATTTCTGG - Intronic
1106999492 13:35526933-35526955 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1107229189 13:38087138-38087160 CTCTGGGGCTCTGTGGTTCCTGG + Intergenic
1107841251 13:44459677-44459699 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1108240233 13:48456891-48456913 CTTTGGGGCCCTGTGGTTTCTGG - Intronic
1108249690 13:48551755-48551777 CTTTGGGGTTCTGCAGTTTCTGG + Intergenic
1108559273 13:51627170-51627192 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1108848236 13:54700207-54700229 CCTTGGGGCTCTGTGGTTTCTGG - Intergenic
1109348561 13:61146126-61146148 CCTTGGGGCTCTGTGGTTTCTGG + Intergenic
1109603674 13:64663752-64663774 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1109837533 13:67878374-67878396 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1109982363 13:69924794-69924816 CTTTGGGGCTCTGTGATTCCTGG + Intronic
1110850689 13:80241413-80241435 CTTTGGGGCTCTGTAGCTCCTGG - Intergenic
1111002762 13:82206237-82206259 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1111141578 13:84126901-84126923 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1111304077 13:86383109-86383131 CTTTGGGGCTTTGCAATTCCTGG + Intergenic
1111337074 13:86838755-86838777 CTTTGGGGTTCTGCAGTTTCTGG - Intergenic
1111478145 13:88781995-88782017 CTGTGGAGTTCAGTAATTTAGGG - Intergenic
1111487714 13:88926370-88926392 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1111549023 13:89783576-89783598 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1111595486 13:90404757-90404779 CTTTGGGGCTCTGTGATTCCTGG + Intergenic
1111987852 13:95083064-95083086 CAGGGGGTCTCTGTAATTTATGG + Intronic
1113108621 13:106798208-106798230 CTATGGGCCTCTGTGATTTTAGG - Intergenic
1114717458 14:24842736-24842758 ATTTGGGGCTATCTAATTTCAGG - Intronic
1115059187 14:29169368-29169390 CTTTGAGGCTCTGCAGTTTCTGG + Intergenic
1116151189 14:41144792-41144814 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1116711644 14:48375347-48375369 CTGTGGGGCTTTTTAATTAGAGG - Intergenic
1116746085 14:48821239-48821261 TTGTGAGGCTTTGTATTTTCAGG - Intergenic
1116961748 14:50974004-50974026 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1118473032 14:66093089-66093111 CTTTAGGGCTCTGTGATTCCTGG - Intergenic
1120590129 14:86364726-86364748 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1121333604 14:93063316-93063338 CTGTGGGTCTCTGCCATCTCAGG - Intronic
1121368745 14:93337807-93337829 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1121708302 14:96017700-96017722 CTCTGTGCCTCTGTAATGTCTGG + Intergenic
1122385999 14:101348711-101348733 CTTTGGGGCTCTGTGGTTTCTGG - Intergenic
1122852358 14:104543521-104543543 CGGTGGGGCTCAGTGATGTCCGG - Intronic
1123012459 14:105356059-105356081 CTGGGGGGCTCTGGCATCTCCGG - Intronic
1123398521 15:19961121-19961143 CTGTGGTGCTCTCTGATTTGGGG + Intergenic
1124468768 15:29964664-29964686 CAGTGGGGCTTTGTGTTTTCAGG - Intronic
1124820966 15:33045075-33045097 CTTTGGGGCTCTGCAGTTTCTGG + Intronic
1125172191 15:36778212-36778234 CTGTGGGGGTCAGTAGCTTCAGG - Intronic
1126215297 15:46146951-46146973 CTCTGGGGCTCTGTGGTTCCTGG + Intergenic
1127812468 15:62576545-62576567 CTGTGGGTCTCTGTACTTATGGG - Intronic
1129519179 15:76175385-76175407 CTGTGGCCCTCTGTACTTTCTGG + Intronic
1131372889 15:91898082-91898104 TTATAGGGCTCTGTCATTTCTGG + Intronic
1131999146 15:98162417-98162439 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1132578160 16:673383-673405 CTGTGGGGCCCTGTGAGTCCAGG + Intronic
1133108048 16:3526881-3526903 GTGTAGGGTTCTGTATTTTCAGG + Intronic
1137219562 16:46434506-46434528 CTGTGGCTCTCTCTAATTCCCGG - Intergenic
1137324417 16:47419733-47419755 CTGTGGGCATTTGTAATCTCAGG - Intronic
1138530374 16:57631377-57631399 CTGGGGGGCTGTGCCATTTCAGG + Intronic
1138925040 16:61580943-61580965 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1139015561 16:62684812-62684834 CTTTGGGGCTCTGCAGTTCCAGG + Intergenic
1139138618 16:64234149-64234171 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1140014516 16:71168657-71168679 CTGTGGGGCAGAGTAATTCCTGG + Intronic
1146425395 17:32732879-32732901 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1147901711 17:43790736-43790758 CTTTCGGGCTCTGCGATTTCTGG - Intergenic
1148339121 17:46863013-46863035 CTGTGGGGCCCTGTACCTTGGGG - Intronic
1149169588 17:53792966-53792988 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1149256780 17:54836391-54836413 CTTTGGGGCTCTGTAGTTCCTGG - Intergenic
1149965023 17:61153629-61153651 CTCTGGGGTTCTGAAATTTTTGG - Intronic
1151460231 17:74249908-74249930 CTGTGGGGCTGTGTCTTTCCTGG + Intronic
1152053693 17:78003736-78003758 CTCTAGGGTTCTGAAATTTCAGG - Intergenic
1152124300 17:78437233-78437255 CAGTGGGGCTCTGTACTCCCAGG + Intronic
1152530556 17:80916263-80916285 CTCTGGGGCTCTGCAGTTCCTGG + Intronic
1153189134 18:2518547-2518569 CTGTAGGCCTCTGTCCTTTCTGG - Intergenic
1154192841 18:12244958-12244980 CCTTGGGGTTCTGTCATTTCAGG + Intergenic
1154309963 18:13259831-13259853 CAGTGGGGCTCAGTCATTACAGG - Intronic
1155248047 18:23929494-23929516 CTCTGTGGCTCTGTAATATCAGG + Intronic
1155248065 18:23929592-23929614 CTCTGTGGCTCTGTAATATTAGG + Intronic
1155248072 18:23929641-23929663 CTCTGTAGCTCTGTAATATCAGG + Intronic
1155819269 18:30353464-30353486 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1156327365 18:36086173-36086195 CTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1157042811 18:44060550-44060572 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1157304769 18:46508946-46508968 CTGTGCGGCTCTGTGCCTTCAGG - Intronic
1157679947 18:49597285-49597307 CTGAAAGGCTCTGTAAGTTCAGG - Exonic
1159292504 18:66440386-66440408 CTTTGGGGCTCTGTGGTTCCCGG + Intergenic
1159834162 18:73316122-73316144 CTGTGGGTTTCTGTGATTTGAGG - Intergenic
1160083488 18:75753250-75753272 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1161238742 19:3210377-3210399 CTGTCGGGCTCAGTAAATGCTGG + Intergenic
1162621525 19:11847990-11848012 TTGTGGGGTTCTGTCCTTTCTGG + Intergenic
1162635456 19:11964267-11964289 TTGTGGGGTTCTGTCCTTTCTGG + Intronic
1162887917 19:13710054-13710076 CTGAGGGGCTCTGTAGGTTTGGG + Intergenic
1162914808 19:13868983-13869005 CTGTGGGTGTCTGTAAGTCCAGG - Intronic
1164615014 19:29662598-29662620 CAGTGGGGCTCGGCATTTTCAGG - Intergenic
1164984515 19:32638629-32638651 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1165956229 19:39503609-39503631 TGGTGGGGCTCTGAAATTTGGGG - Intronic
1166495498 19:43300190-43300212 CTGTGGGTCTCTCCAATTTATGG + Intergenic
1167564619 19:50248640-50248662 CTTAGGGGCTGTGTGATTTCAGG - Intronic
925131757 2:1498632-1498654 CTCTGGGGCACTGTAATCTCTGG - Intronic
927236387 2:20879575-20879597 CTTTGGGGCTCTGCAATTCCTGG - Intergenic
928321542 2:30287257-30287279 CTGTGGGGGTCTGAAATATCAGG + Intronic
928796905 2:35034113-35034135 CTTTGGGGATCTGTGATTCCTGG - Intergenic
930313543 2:49771329-49771351 CTTTGGGGCTCTGTGTTTCCTGG - Intergenic
930729102 2:54710210-54710232 CTTTAGGGCTCTGCAGTTTCTGG + Intergenic
932398170 2:71462378-71462400 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
933455001 2:82508670-82508692 CTTTGGGGCTCTGCAGTTTCTGG + Intergenic
934847823 2:97673668-97673690 CTGTGTGGCTGTGTCATGTCTGG + Intergenic
938023038 2:127921782-127921804 GTTTGGGGCTCTGTAATGTTGGG + Intergenic
939084809 2:137707211-137707233 CTCTGGGGCTCTGTGGTTTGTGG - Intergenic
940497757 2:154455022-154455044 CAGTGGAGCTCTGTAAACTCTGG + Intergenic
940711109 2:157164714-157164736 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
941131154 2:161651568-161651590 CTTTGGGGCTCTGCGGTTTCTGG + Intronic
941151492 2:161919894-161919916 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
941432412 2:165427713-165427735 CTTTGGGGCTCTGTGATTCCTGG + Intergenic
942114256 2:172712660-172712682 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
942683200 2:178501226-178501248 CTGTGGGGCTCTGTAATTTCTGG + Intronic
943064199 2:183069751-183069773 CTTTGGGGCTCTGTAATTTTTGG + Intergenic
943191131 2:184680877-184680899 CTTTGGGGCTCTGCAGTTGCTGG + Intronic
943191610 2:184685291-184685313 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
943224064 2:185145470-185145492 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
943426619 2:187745746-187745768 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
943426909 2:187749358-187749380 CTTTGGGGCTGTGCAGTTTCTGG - Intergenic
943858508 2:192828946-192828968 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
943928406 2:193819112-193819134 CTTTGGGGCTCTGGAGTTCCTGG - Intergenic
944146844 2:196515035-196515057 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
945538645 2:211054132-211054154 CTGTGGGACTGTGTAATTGAAGG + Intergenic
948334833 2:237199940-237199962 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1168993551 20:2115254-2115276 CTGTGAGCCTTGGTAATTTCAGG + Intronic
1169309427 20:4522277-4522299 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1170221652 20:13947711-13947733 CTTTGGGGCACTGTGGTTTCTGG + Intronic
1170327940 20:15176871-15176893 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1170458469 20:16554752-16554774 CTTTGGGGCTCTGTGGTTTCTGG + Intronic
1171175176 20:23047022-23047044 CTCTGGGAATCTGAAATTTCAGG + Exonic
1171988769 20:31679318-31679340 CTGTGACGCTCTGAAATTTCTGG - Intronic
1172237166 20:33385471-33385493 TAGTGGAGCTCTGTAATTTGTGG + Intronic
1173100171 20:40080200-40080222 CTGTGTGGCTCTGCAATTTCAGG + Intergenic
1173740235 20:45395049-45395071 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1174557713 20:51407674-51407696 CTGTGGGCCTCTGCAACTTTGGG - Intronic
1176104691 20:63380455-63380477 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1176745212 21:10645863-10645885 CTGTGGTGCTCTCTGATTTGGGG + Intergenic
1176976596 21:15327847-15327869 CTTTGGGGCTTTGTAGTTCCGGG + Intergenic
1176993032 21:15521602-15521624 CTTTGGGGCTCTGTAGTTCCTGG - Intergenic
1178467000 21:32858213-32858235 CCTTGGGGCCCTGTGATTTCTGG - Intergenic
1178937515 21:36875903-36875925 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1179556484 21:42181312-42181334 CTCTGGGGCTCTGTCATTTTGGG + Intergenic
1180988069 22:19917281-19917303 CTGTGGGGCTCTGTATCCCCTGG - Intronic
949226456 3:1700633-1700655 CTCTGGGGCTCTGTGGTTCCTGG + Intergenic
949837378 3:8283724-8283746 CTGTGTGGCTCTGTGACTTCTGG - Intergenic
951509574 3:23486346-23486368 CTATGGGGCTCTGAAGTTCCTGG - Intronic
952033873 3:29176609-29176631 CCCTGGAGCTCTGTAATTTCTGG + Intergenic
952657269 3:35801524-35801546 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
952870441 3:37895413-37895435 CTTTCTGGCTCTGTACTTTCTGG + Intronic
952969535 3:38641992-38642014 CTCTGGGTCTCTGTGGTTTCAGG - Intronic
956101945 3:65777761-65777783 CTGCAGTGCTGTGTAATTTCTGG + Intronic
957417983 3:79930142-79930164 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
957486765 3:80871578-80871600 CTTTGGAGCGCTGTAGTTTCTGG + Intergenic
957614591 3:82510140-82510162 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
957665086 3:83217284-83217306 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
957788060 3:84906036-84906058 CTTTGGGGCTCTGTGGTTCCCGG + Intergenic
957923162 3:86772784-86772806 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
958141681 3:89570800-89570822 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
958491297 3:94777257-94777279 CTGTGGGGCTCCCTTAGTTCTGG - Intergenic
959037560 3:101384440-101384462 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
961525901 3:127497150-127497172 CTTTGGGGCTCTGTGTTTCCTGG + Intergenic
961615633 3:128177564-128177586 TTGTAGGTCTCTGAAATTTCTGG + Intronic
962918814 3:139933639-139933661 ATGTGGGGCTCTTTACCTTCAGG - Intergenic
963250292 3:143096362-143096384 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
963346361 3:144099872-144099894 CTTTGGGGTTCTGTGGTTTCTGG + Intergenic
964075091 3:152683925-152683947 CTTTGGGGCTCTGCAATTCCTGG - Intergenic
965115125 3:164478320-164478342 CTTTAGGGCTCTGCAGTTTCTGG + Intergenic
965748733 3:171954303-171954325 CTGTGGGACTTTGTATTTTCTGG + Intergenic
965773873 3:172208995-172209017 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
966124384 3:176558699-176558721 CTGTGGGGCTCTGTTTCTGCAGG + Intergenic
967332725 3:188307953-188307975 CTGTGCGTGTGTGTAATTTCGGG + Intronic
967508479 3:190281656-190281678 AGTTGGAGCTCTGTAATTTCCGG + Intergenic
968980696 4:3847920-3847942 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
969179322 4:5424908-5424930 CTTTGGGGCTCTGCATTTCCTGG + Intronic
970425412 4:15941133-15941155 CTGAGGGGCTCTGTAATTCTTGG + Intergenic
970959755 4:21857897-21857919 CTTTGGGGTTCTGCAGTTTCTGG + Intronic
971813749 4:31461224-31461246 TTGTTGGGCTCTGTTCTTTCTGG - Intergenic
972645922 4:40967446-40967468 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
974515133 4:62898146-62898168 CTTTGGGGCTCTGTGTTTCCCGG + Intergenic
974664968 4:64949754-64949776 CTTTTTGGCTCTGCAATTTCAGG - Intergenic
974686732 4:65241539-65241561 CTTTGGGGCTCCGCAGTTTCTGG - Intergenic
974698012 4:65399114-65399136 CTTTGGGGCTTTGCAGTTTCTGG + Intronic
976734436 4:88296039-88296061 CTTTGGGGCCCTGAAATTCCTGG - Intergenic
977410375 4:96654084-96654106 CTTTGGGGCTCTGCCATTCCTGG + Intergenic
977487250 4:97665094-97665116 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
977710717 4:100121152-100121174 CTGTGGGAATCTGTAAATGCGGG - Intergenic
977816155 4:101416324-101416346 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
978219627 4:106255584-106255606 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
978248479 4:106603756-106603778 CTATGGGGCTCTGCAGTTCCTGG - Intergenic
978347553 4:107788048-107788070 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
978466827 4:109017056-109017078 CTTCGGGGCTCTGTGATTTCTGG + Intronic
980007688 4:127559998-127560020 CTTTGGGGCCCTGCAGTTTCTGG + Intergenic
980282392 4:130737864-130737886 CTTTGGGTCTCTGCAGTTTCTGG + Intergenic
981889114 4:149715448-149715470 CTTTGGGGCTCTGTGATTCCTGG - Intergenic
982403860 4:154998934-154998956 CTGTGGGTCTCTGCAGTTTTTGG + Intergenic
983492010 4:168399320-168399342 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
984526605 4:180866127-180866149 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
984763908 4:183384965-183384987 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
985776438 5:1846537-1846559 CTGGGAGGGCCTGTAATTTCTGG - Intergenic
987710436 5:21496586-21496608 TTGTGGGGCAGGGTAATTTCAGG + Intergenic
989821785 5:45801213-45801235 CTTTGGGGCTCTGTGTTTTCTGG + Intergenic
990878863 5:60517995-60518017 CTTTGGGGCTCTGTAGTTCCTGG + Intronic
991039581 5:62162005-62162027 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
991737429 5:69640780-69640802 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
991760764 5:69915645-69915667 TTGTGGGGCAGGGTAATTTCAGG + Intergenic
991786567 5:70202456-70202478 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
991789005 5:70220506-70220528 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
991813755 5:70495612-70495634 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
991816885 5:70516896-70516918 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
991839993 5:70790696-70790718 TTGTGGGGCAGGGTAATTTCAGG + Intergenic
991879011 5:71202841-71202863 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
991881451 5:71220870-71220892 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
992029589 5:72708475-72708497 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
992456467 5:76920695-76920717 CTGTGTGGGTCTTTGATTTCAGG + Exonic
992838832 5:80667762-80667784 CTCTGGGGCTCTGCAGTTCCTGG - Intronic
993617929 5:90136295-90136317 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
994422386 5:99536693-99536715 TTGTGGGGCAGGGTAATTTCAGG + Intergenic
994459987 5:100060847-100060869 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
994518053 5:100794788-100794810 CTTTGGGGCTCTGCATTTCCTGG + Intergenic
994592503 5:101790489-101790511 CTGTGGTGCTCTGTTATGACAGG - Intergenic
994692278 5:103034024-103034046 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
994753133 5:103763731-103763753 CTATGGGGCTCTGTGGTTCCTGG - Intergenic
994891402 5:105640352-105640374 CTTTTGGGCTCTGTAGTTCCTGG + Intergenic
995332621 5:110962188-110962210 CTGTAAGCTTCTGTAATTTCAGG - Intergenic
995386717 5:111596707-111596729 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
996217412 5:120886856-120886878 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
997249633 5:132378444-132378466 CTGTTGGGCTCCTTCATTTCAGG + Exonic
999887071 5:155936064-155936086 CTTTGGGCCTCTGTGATTCCTGG - Intronic
1000266361 5:159641661-159641683 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1000472337 5:161660827-161660849 CTTTGGGGCTCTGCAATTCCTGG + Intronic
1001568736 5:172716629-172716651 CTTTGGGGCTCTGCACTTTGGGG + Intergenic
1006535816 6:34697745-34697767 TTTTGGGGCTCTGTATTTTTTGG - Intergenic
1008231684 6:48990731-48990753 CTTTGGGTCTCTGTGGTTTCTGG + Intergenic
1009018016 6:57925004-57925026 TTGTGGGGCAGGGTAATTTCAGG - Intergenic
1009243283 6:61204436-61204458 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1009306875 6:62102424-62102446 CTTTGGGGCTCTGCAATCCCTGG - Intronic
1009588717 6:65638508-65638530 CTTTGGGGCTCTGTGGTTCCTGG + Intronic
1009643015 6:66362273-66362295 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1010332455 6:74639859-74639881 CTGTGGGGTTTTGTAATGTGAGG - Intergenic
1010846979 6:80720780-80720802 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1011495519 6:87933551-87933573 CTGTGGGGCTCAGAAGATTCAGG - Intergenic
1011822541 6:91270910-91270932 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1012709639 6:102582539-102582561 CTTTGGGGTTCTGTAATTCCTGG + Intergenic
1012749448 6:103139765-103139787 CTTTGGGGCTCTATGATTCCTGG - Intergenic
1013438508 6:110138284-110138306 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1014227076 6:118861259-118861281 CTTTGGGGCTCTGCAGTTCCTGG - Intronic
1014391791 6:120873185-120873207 CTGTGGGGCTCTGTGGCTCCTGG + Intergenic
1014418662 6:121214619-121214641 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1016076667 6:139804546-139804568 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1016237948 6:141890756-141890778 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1016580814 6:145627771-145627793 CTGTGCAGCCCTGTGATTTCAGG - Intronic
1016653908 6:146495885-146495907 CAGTGAGCCTCTGAAATTTCAGG + Intergenic
1016758769 6:147715467-147715489 CTCTGGGGCTCTGTGGTTCCTGG - Intronic
1020474766 7:8582199-8582221 CTTTGGGGCTCTGTGATTCCCGG - Intronic
1020586879 7:10079632-10079654 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1021343030 7:19488433-19488455 CTTTGGGGCTCTGTGGTTTCTGG - Intergenic
1022208056 7:28181414-28181436 CAGTAGGGTGCTGTAATTTCGGG - Intergenic
1022391982 7:29951115-29951137 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1024024724 7:45400593-45400615 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1026391944 7:69911305-69911327 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1026393517 7:69927867-69927889 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1027911904 7:84261480-84261502 ATTTGGGGCTCTGTGATTTTTGG + Intronic
1028052170 7:86202124-86202146 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1028053002 7:86208120-86208142 CTTTGGAGCTCTGCAGTTTCTGG - Intergenic
1028054445 7:86225450-86225472 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1028143004 7:87292040-87292062 CTGTGCCTCTCTGCAATTTCAGG - Intergenic
1030359545 7:108580318-108580340 CTTTGGGGCTCTATAGTTCCTGG + Intergenic
1030722035 7:112882002-112882024 CTTTGGGGCTCTGTGGTTTCTGG + Intronic
1032591106 7:133193268-133193290 CTTTGGGGCTCTGTAGTTCCTGG - Intergenic
1033267370 7:139897725-139897747 CTGCAGGGCTCTGTGAATTCAGG + Intronic
1035849301 8:2899350-2899372 CTGTGGTGTTCTGTGATTACAGG + Intergenic
1037131252 8:15410606-15410628 CTGTGGTTCCCTGTAGTTTCAGG - Intergenic
1039210065 8:35204008-35204030 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1041222443 8:55665255-55665277 ATTTGGGGCTCTGTAGTTCCTGG - Intergenic
1041274497 8:56143087-56143109 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1041965399 8:63669700-63669722 CTTTGAGGCTCTGTGGTTTCTGG - Intergenic
1042005004 8:64169934-64169956 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1042439586 8:68810408-68810430 CTTTGGGGCTCTGTGGTTCCTGG - Intronic
1043082457 8:75783980-75784002 CTCTGGGACTCTGTAATTTCTGG - Intergenic
1043702765 8:83312303-83312325 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1043707969 8:83377620-83377642 CTTTGGGGCTCTGCAGTTTCTGG - Intergenic
1043758396 8:84032311-84032333 CTCTGGGGCTCTGCAGCTTCTGG + Intergenic
1043980672 8:86635245-86635267 CTGTGGGTCTCTTTAAATTAAGG + Intronic
1044774864 8:95677638-95677660 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1046195817 8:110861262-110861284 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1046407246 8:113790608-113790630 CTTTGGGGCTCTGTGGTTCCCGG - Intergenic
1046486444 8:114894462-114894484 CTGTGATGTTCTGTAAGTTCAGG + Intergenic
1046813341 8:118556612-118556634 CTGTGTGGCTTTGTTATCTCTGG - Intronic
1047725102 8:127677457-127677479 CTGGGGAGCTCTGTAATATTAGG - Intergenic
1047867255 8:129039971-129039993 TTTTGAGGCTCTGTTATTTCAGG + Intergenic
1049078914 8:140425411-140425433 CTGTGGGGCTTTGTTATTCAAGG - Intronic
1049781733 8:144432243-144432265 CTCTGAGGCTCAGTATTTTCTGG + Intronic
1050484050 9:6115140-6115162 CTTTGGGGCCCTGTGGTTTCTGG + Intergenic
1050589565 9:7148203-7148225 CTCTGGGGCTCTGCACTTCCTGG - Intergenic
1050937303 9:11414251-11414273 CTTTGGGGCTCTGCAGTTCCTGG + Intergenic
1051726205 9:20089781-20089803 CTGTGGTGTGCTGTAAGTTCTGG - Intergenic
1052407700 9:28083243-28083265 CTGTAGGGCTCTGTCATTCCTGG + Intronic
1052552460 9:29969187-29969209 CTTTGGGGCTCTTTGATTCCTGG - Intergenic
1052597260 9:30575686-30575708 CTTTTGGGCTCTGCAATTTCTGG + Intergenic
1052609774 9:30758155-30758177 CTTTGGGGCTCTGCCATTCCTGG - Intergenic
1052623607 9:30944889-30944911 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1052652301 9:31320840-31320862 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1052691546 9:31821595-31821617 CTTGGGGGCTCTGCAGTTTCTGG + Intergenic
1055890827 9:81122135-81122157 CTTTGGGGCTCTGTGGTTCCTGG - Intergenic
1056462247 9:86819032-86819054 TTTTGGGGCTCTGTGGTTTCTGG + Intergenic
1057598765 9:96438994-96439016 TTATGGAGCTCTGTACTTTCTGG + Intergenic
1059104911 9:111502453-111502475 CTCTGGGGCTCTGTGGTTTCTGG + Intergenic
1059130122 9:111738498-111738520 CTGTGGGGCTCTTGAATTCTTGG + Exonic
1059174755 9:112159216-112159238 CTCAGTGCCTCTGTAATTTCAGG + Intronic
1059718040 9:116931808-116931830 GTGTGGGGTTGAGTAATTTCAGG + Intronic
1059788723 9:117616568-117616590 CTGTGGGGTTCTGGATTTGCAGG + Intergenic
1060603485 9:124894158-124894180 ATGTGGGGCTCTGGAAGTACAGG - Intronic
1061411103 9:130422209-130422231 CTGTGGGTCTCTGAAATGCCGGG - Intronic
1061731056 9:132614377-132614399 CTGTGGGGCTCTGTATCTAGTGG - Intronic
1061736328 9:132662439-132662461 CTGTGGAGTTCTGGAATGTCAGG + Exonic
1061743134 9:132721998-132722020 CTCTGGGGCTCTGTGGTTCCTGG - Intergenic
1062329215 9:136029625-136029647 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1185936057 X:4257991-4258013 CTTTGGGGCTCTGTGGTTCCTGG + Intergenic
1186072727 X:5839814-5839836 CTGTGGGGCTGTGGACCTTCAGG + Intergenic
1187871119 X:23766298-23766320 CTTTGGGGCTCTGCGGTTTCTGG - Intronic
1188727659 X:33606384-33606406 CTTTGGGGCTCTATGATTCCTGG - Intergenic
1189186592 X:39060423-39060445 CTTTGGGGCTCTGTAGTTGCTGG - Intergenic
1192178818 X:68902739-68902761 CTGTGGGGTTCTGTAGATTTAGG - Intergenic
1193417518 X:81241745-81241767 CTTTGGGGCTCTGCAGTTCCTGG + Intronic
1194000315 X:88420484-88420506 CTTTGGGGCTCTGCAGTTCCTGG - Intergenic
1197119247 X:122870669-122870691 CTTTGGGGCCCTGACATTTCTGG - Intergenic
1199258560 X:145744816-145744838 CTCTTGGGGTCTGTAATTCCAGG + Intergenic
1200151452 X:153953398-153953420 CTCTGGGGCGCTTTTATTTCTGG - Intronic
1200237921 X:154478155-154478177 CTGAGGGGCTGTGTAATGGCAGG - Intronic
1200972222 Y:9164803-9164825 CTTGGGGGCTGTGCAATTTCTGG + Intergenic
1201383597 Y:13413598-13413620 CTTTGGGGCTTTGTGGTTTCTGG + Intronic
1201720390 Y:17090085-17090107 CTTTGGGGCCCTGTGATTCCTGG + Intergenic
1202133526 Y:21636103-21636125 CTCTGGGGCTCTCCAGTTTCTGG + Intergenic