ID: 942688065

View in Genome Browser
Species Human (GRCh38)
Location 2:178555037-178555059
Sequence AACCTGCGCCTACTATTGAG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 33
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 31}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942688065 Original CRISPR AACCTGCGCCTACTATTGAG TGG (reversed) Exonic
906569659 1:46825958-46825980 ATCCTTCGCCTACTTTTGATGGG + Intergenic
915838539 1:159197380-159197402 CACCTGCGCCTGCACTTGAGAGG - Intronic
917361130 1:174177301-174177323 ATCCTTCGCCTACTTTTGATGGG + Intronic
919137843 1:193533000-193533022 GACCAGGGCCTACTATAGAGTGG + Intergenic
919545288 1:198909894-198909916 AACCTGCCACTAGTCTTGAGAGG - Intergenic
919604604 1:199666512-199666534 ATCCTGAGCCCACTATTGATTGG - Intergenic
1082824744 11:57569249-57569271 AACAAGCGCCTACTACTGAGTGG + Intergenic
1101193045 12:102354527-102354549 AACCTACGCCTACATTTCAGAGG - Intergenic
1111861918 13:93718426-93718448 ATCCTTCGCCTACTTTTGATGGG + Intronic
1128743674 15:70099258-70099280 AACCTCCGGCTCCTAATGAGGGG - Intergenic
1140714716 16:77712040-77712062 AACCTGCCCTTACTTCTGAGGGG - Intergenic
942688065 2:178555037-178555059 AACCTGCGCCTACTATTGAGTGG - Exonic
945081709 2:206092432-206092454 AACCTCTGCCTATTATTCAGAGG - Intergenic
946361155 2:219220068-219220090 AACCTGTGCCAACTGTGGAGTGG - Exonic
1173877118 20:46380348-46380370 CACCTGTGACTACTATCGAGAGG + Intronic
1177478161 21:21651108-21651130 AACCTCCGCCTACATTTCAGAGG + Intergenic
1177553221 21:22653564-22653586 ACCTTGCGCCTCCTATTCAGTGG - Intergenic
1182916157 22:34033976-34033998 ATCCTTCGCCTACTTTTGATGGG - Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
959501691 3:107114104-107114126 AACCTGTTCATCCTATTGAGGGG + Intergenic
961634105 3:128322091-128322113 AAACTGCTCCTGCTATAGAGGGG - Intronic
966276979 3:178185070-178185092 GACCTGCAGCTACTATTCAGAGG - Intergenic
974981890 4:68967164-68967186 AACCTCCACCTACTTTTCAGAGG - Intergenic
978516724 4:109576759-109576781 AACCTTGGACTACTATTGATGGG + Intronic
978991246 4:115084747-115084769 AACCTCCGCCTATAATTCAGAGG + Intronic
985884771 5:2668911-2668933 AGCCTGCGGCCACTCTTGAGGGG + Intergenic
1008069696 6:47086763-47086785 AAGCTGAGGCTTCTATTGAGTGG + Intergenic
1018989553 6:168663127-168663149 AACCTGAGCCCACCAGTGAGTGG + Intronic
1019744345 7:2691261-2691283 GACCTTCCCCTACTCTTGAGGGG - Intronic
1022457384 7:30570036-30570058 AATCTCCTCCTACTAGTGAGAGG + Intergenic
1035487472 7:159237217-159237239 AACCTCCGACTACCACTGAGGGG + Intergenic
1039107411 8:34004263-34004285 AACCTCCGCCTAGAGTTGAGAGG - Intergenic
1194843617 X:98776105-98776127 AACCTCCGCCTAGTTTTCAGAGG + Intergenic