ID: 942689498

View in Genome Browser
Species Human (GRCh38)
Location 2:178570497-178570519
Sequence ACAGGTCCTTCAGGTGGCCC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 250}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942689493_942689498 20 Left 942689493 2:178570454-178570476 CCAAGCTAGTGTGCATTTTTCTG 0: 1
1: 0
2: 1
3: 19
4: 279
Right 942689498 2:178570497-178570519 ACAGGTCCTTCAGGTGGCCCTGG 0: 1
1: 0
2: 2
3: 20
4: 250

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942689498 Original CRISPR ACAGGTCCTTCAGGTGGCCC TGG Exonic
902222837 1:14977735-14977757 AGAGGTCCACCAGGTGGCTCTGG + Intronic
902372939 1:16016927-16016949 ACAAGGCCTTCAGTTAGCCCTGG + Intronic
903295862 1:22342819-22342841 ACAGGTCCTACAGCTCCCCCTGG + Intergenic
903692511 1:25184317-25184339 AGGGGCCCTCCAGGTGGCCCTGG - Intergenic
905167582 1:36092038-36092060 CCAGATCCTCCATGTGGCCCAGG - Exonic
905481588 1:38265625-38265647 ACATGTCCTTCCAGTTGCCCAGG + Intergenic
905506021 1:38480384-38480406 CCAGTTCCTTCTGGAGGCCCAGG - Intergenic
905935159 1:41817580-41817602 ACAGGTCCTCCTGGTGACCTGGG - Intronic
907040384 1:51253495-51253517 ACAGGATCTTGAGGTTGCCCAGG - Intronic
907327689 1:53651495-53651517 ACAGTACCTTCAGGTGGGTCTGG + Intronic
909515113 1:76498113-76498135 ACAGCTGCTTCTGGTAGCCCAGG + Intronic
912010714 1:104958011-104958033 ACAGGTTCTTCTGCTGGCACTGG - Intergenic
912988984 1:114464942-114464964 ACTGGTCCTTCTGGTGGCTCTGG - Intronic
914947852 1:152081473-152081495 TCAGGTCATTCAGGTGGTCATGG + Intergenic
915544166 1:156586465-156586487 TCAGGTCATCCAGGTGGCCCAGG + Exonic
916080687 1:161230086-161230108 AAAGGTCCTCCAGGGGGCCTCGG + Exonic
916727085 1:167533096-167533118 GCTGGTCCTTCAGATGCCCCAGG - Intronic
918225121 1:182474263-182474285 TCAGCTTCTTCAGGTGGTCCCGG - Exonic
919795962 1:201321800-201321822 TCAGGTCCCAGAGGTGGCCCTGG + Intronic
920738955 1:208561801-208561823 ACAGGTGACTCAGGTGGCACAGG + Intergenic
922471197 1:225878364-225878386 AGAGGTCCCTGAGGAGGCCCTGG - Intronic
922825298 1:228513428-228513450 GCAGCTCCTTCAGCTGGCCTGGG - Intergenic
923087109 1:230710268-230710290 ACAGGGCCTGCTAGTGGCCCAGG - Exonic
1064322830 10:14321745-14321767 AGAGGCCCTGCAGGTAGCCCAGG + Intronic
1064702645 10:18037687-18037709 CCAGGTCTTTCAGGTTGTCCTGG - Intronic
1065070275 10:22016172-22016194 CCAAGTCCTTCACTTGGCCCCGG - Intergenic
1066026689 10:31364714-31364736 TCAGGTCATTCAGGTGGTCATGG + Intronic
1067237090 10:44460167-44460189 ACTGGTTCGTCAGGTGTCCCAGG - Intergenic
1070238578 10:74655664-74655686 ATATGTCCTTCGGGAGGCCCGGG - Intronic
1071298167 10:84237544-84237566 ACAGCTGCTCCAGGCGGCCCAGG + Exonic
1071508365 10:86246311-86246333 ACAGGGCCCTCAGGGAGCCCAGG - Intronic
1071883231 10:89922149-89922171 ACAAGCCCTTCAGGTGACTCTGG - Intergenic
1073243605 10:102074205-102074227 CCAGGGCCTCCAGGAGGCCCAGG - Intergenic
1073447824 10:103591754-103591776 TTAGGTACCTCAGGTGGCCCAGG + Exonic
1073511168 10:104043500-104043522 CCAGGACCTCCAGGTGCCCCAGG - Exonic
1075160347 10:120019061-120019083 ACATGTCCATCAGGAAGCCCAGG + Intergenic
1075485655 10:122820170-122820192 CCAGCTCCCTCAGGAGGCCCTGG + Intergenic
1076944641 10:133637792-133637814 CCGGGGCCTGCAGGTGGCCCTGG - Intergenic
1077177097 11:1195939-1195961 CCAGGTCCGTCATGTGGCACCGG - Intronic
1077606693 11:3617151-3617173 ACAGGTCCTTCTGGCAGGCCTGG - Intergenic
1078067172 11:8086107-8086129 ATAGGTCTTTCAGCTGACCCTGG - Intronic
1078264929 11:9747981-9748003 ACAGGCCCTGCAGGAGGCCATGG + Exonic
1078356223 11:10633656-10633678 ACAAGTCCTTCTGGGGCCCCTGG + Intronic
1080643748 11:34173635-34173657 TGAGGGCCCTCAGGTGGCCCAGG + Intronic
1082050120 11:47764137-47764159 ACAGGTTCTTACGGTCGCCCAGG + Intronic
1082972285 11:59036490-59036512 ACAGGTCCTTCAGGGGGTCATGG - Intronic
1082976756 11:59080374-59080396 GCAGGTCCTTCAGGGGGTCATGG - Intergenic
1083150254 11:60787319-60787341 ACAGGTCCTGGAAGTGGGCCAGG + Intronic
1084447578 11:69212699-69212721 ACGGTTCCTTCAGGTGGGCCTGG - Intergenic
1084938373 11:72599360-72599382 CCACGTCCCTGAGGTGGCCCAGG + Intronic
1085455569 11:76663585-76663607 ACAGGGGCCTCAGGAGGCCCAGG + Intronic
1087039460 11:93784564-93784586 GCAGGTCCATGAGGTGGGCCTGG + Exonic
1090335572 11:125960950-125960972 AGAGGTCCTTCAGCAGCCCCGGG - Exonic
1090534340 11:127624308-127624330 ACAGGTCCTCCAGGTCACCAAGG - Intergenic
1090868693 11:130724255-130724277 ACAGGCCCTTCAGGTGACTGAGG + Intergenic
1092055818 12:5507208-5507230 ACCCATCCTTCAGGAGGCCCCGG + Intronic
1094628324 12:32147376-32147398 AAAGGTCGTTCAGGTGGCGGTGG + Intronic
1094692114 12:32779702-32779724 ACTTGTCCTTCAAGTCGCCCAGG + Intergenic
1095957577 12:47815524-47815546 ACAGGTGCTTCAGGTGATCCTGG - Intronic
1095981701 12:47978017-47978039 ACGGGTCCTGCAGGTGAACCTGG - Exonic
1098167628 12:67714506-67714528 GCATGTCATTCACGTGGCCCTGG - Intergenic
1099592866 12:84618074-84618096 ACACGTCCTTCATGTGGCGCAGG - Intergenic
1102214087 12:111147842-111147864 ACGAGTCCTCCAGGGGGCCCAGG + Intronic
1102597737 12:114005761-114005783 ACAGATCTTTCATGTGGCCTAGG - Intergenic
1102955234 12:117054610-117054632 AGGGGTCCTTCAGCTGCCCCTGG - Intronic
1104416383 12:128599394-128599416 ACAGGACCTTCCTGTGGCACTGG + Intronic
1104721001 12:131045209-131045231 ACAGGTCCTGCGGGCTGCCCTGG - Intronic
1105210406 13:18253844-18253866 ACAGGGGCTCCAGATGGCCCAGG + Intergenic
1107978320 13:45711601-45711623 CCAGCTCCTTCAGGTGTTCCTGG - Intronic
1108213920 13:48165108-48165130 CCTGGGCCTCCAGGTGGCCCAGG - Intergenic
1110627056 13:77663291-77663313 TCAGGTCATTCAGGTGGTCATGG + Intergenic
1113451050 13:110409965-110409987 CTAGGGCCATCAGGTGGCCCTGG + Intronic
1113889083 13:113726592-113726614 GCAGGTCCCTCAGGAGGCCTGGG + Intronic
1113903997 13:113811116-113811138 GCTGCTCCTTCTGGTGGCCCTGG + Intronic
1114670369 14:24407865-24407887 ACAGGCCCTTCAGGTATTCCTGG - Exonic
1117980718 14:61339874-61339896 AAAGGTCCTCTAGGTTGCCCAGG + Intronic
1118532223 14:66718957-66718979 ACACGTCCTTCAGGTTGTCAGGG + Intronic
1119428543 14:74551270-74551292 GCAGATCCACCAGGTGGCCCAGG - Exonic
1119668938 14:76504292-76504314 CCAGGTGCCTCTGGTGGCCCAGG - Intergenic
1119697119 14:76721859-76721881 ACTGGTCCTACAGGGGGCCCAGG - Intergenic
1120160437 14:81139721-81139743 TCAGTTCCTTCAGGTGCTCCAGG - Exonic
1121435655 14:93917534-93917556 ACAGGTGCTCCAGGTGGCTGGGG + Intergenic
1122246521 14:100407028-100407050 ACAGCTCCTTGAGGCTGCCCTGG - Intronic
1122924180 14:104892180-104892202 GCAGGACCTGCTGGTGGCCCAGG + Intronic
1202926605 14_KI270724v1_random:31462-31484 CCGGGGCCTGCAGGTGGCCCTGG + Intergenic
1124014042 15:25861793-25861815 ACAGGGCCTTGAGGTGGTCCAGG + Intronic
1126572690 15:50168858-50168880 ACCAGCCCTTCAGGTGGCCTGGG + Intronic
1131066329 15:89436908-89436930 CCAGGTCCTTCTGGTGTCCTCGG + Intergenic
1132221807 15:100110765-100110787 GTGGGTCCTTCTGGTGGCCCCGG + Intronic
1132557593 16:579421-579443 ACAGGCCCTAGAGGTGCCCCGGG + Intronic
1132757833 16:1494518-1494540 ACAGCTCCTCCAGGCGGCCATGG - Exonic
1132999584 16:2842181-2842203 ACAGGTCCTTCTGGTGGGAAGGG - Intergenic
1133453219 16:5920759-5920781 AAACGTCCTTCAGGAGGACCTGG + Intergenic
1133984820 16:10660427-10660449 AAAGGTCAGTCAGGAGGCCCAGG + Intronic
1137000082 16:35221951-35221973 CCAGGGCCTGCAGGTGACCCTGG - Intergenic
1137026911 16:35486132-35486154 CCCGGACCTGCAGGTGGCCCTGG - Intergenic
1139765223 16:69223032-69223054 ACAAGTACTTCAGGAGGCCGAGG - Intronic
1141111868 16:81276459-81276481 ACAGGCCCATGAGGTGGCCAGGG + Intronic
1142995667 17:3758795-3758817 CAAGGTCCTTCAGTTTGCCCGGG + Intronic
1143502653 17:7348111-7348133 ACATGAGCTTCAGGAGGCCCAGG - Exonic
1145935967 17:28715071-28715093 AGACGCCCTCCAGGTGGCCCAGG - Exonic
1147324409 17:39663419-39663441 AAAGGTCCCCCAGGAGGCCCTGG - Exonic
1150716692 17:67578336-67578358 ACAGGTCCCACTGCTGGCCCTGG - Intronic
1151996365 17:77611840-77611862 CCAGGTCCATCAGGAGGCTCCGG + Intergenic
1152413824 17:80146368-80146390 TCAGGTTCTTCAGGTTGCCTGGG + Intronic
1152946855 17:83202702-83202724 AAAGGTCCTTCAGATTGTCCAGG + Intergenic
1155497898 18:26460589-26460611 GCAGCTCCATCAGGTGGCACAGG - Intronic
1157288133 18:46391355-46391377 ACAGCTCTTTCAGGTTGTCCTGG + Intronic
1157662732 18:49460222-49460244 ACAGCCCCTCCGGGTGGCCCAGG + Intronic
1158428800 18:57364668-57364690 ACAGGTCAATCAGCTGGCCAAGG - Exonic
1159868634 18:73735547-73735569 ATGGGTCCTGCAGGTGGTCCTGG - Intergenic
1160240464 18:77119097-77119119 ACAGGTCCCTGAGGTGGAGCTGG + Intronic
1161038567 19:2098314-2098336 ACATGTAGTTCAGGAGGCCCTGG - Exonic
1161104899 19:2438476-2438498 CCAGGTCCTTCACACGGCCCTGG + Exonic
1161801038 19:6416851-6416873 CCAGGTCCTCCAGGGGGTCCAGG - Exonic
1163036786 19:14574274-14574296 ACAGGTCACACAGGTAGCCCTGG - Intergenic
1163444603 19:17339136-17339158 ACGGGCACTGCAGGTGGCCCTGG + Exonic
1163754451 19:19098234-19098256 ACACGTCCTCCAGGTGCCACTGG + Intronic
1163778664 19:19233494-19233516 CGAGGTCCTTCAGGCAGCCCTGG + Intronic
1164702663 19:30296811-30296833 CTAGGTCCTTCTGGTGGCCAGGG + Intronic
1164735228 19:30536253-30536275 ACAGGTCCTGCAGCTGGAACAGG - Intronic
1165329487 19:35133691-35133713 ACAGGTACTGCAGGTGGGACAGG + Exonic
1165399110 19:35586341-35586363 CCAGGTGCTTCAGCTGCCCCAGG + Intergenic
1165663846 19:37608704-37608726 TAAGGTCCATCAGGTGGCACAGG - Intronic
1168373775 19:55858569-55858591 ACAGGGCCTTCAGCTGGTGCTGG - Exonic
925388906 2:3482531-3482553 GCAGGACCTGCAGGTGACCCCGG - Intronic
928206534 2:29288492-29288514 ACAGGGTCTTCAGGTGGCCCAGG + Intronic
932063618 2:68530128-68530150 TCAGGTCATTCAGGTGGTCATGG + Intronic
933678251 2:85076868-85076890 CTAGGGCCTTAAGGTGGCCCAGG + Intergenic
934989531 2:98911615-98911637 CCAGCTCCTTCAGGTGGGCTTGG - Intronic
935810791 2:106794922-106794944 ACATGTCCAACAGGTGGCACTGG - Intergenic
937308667 2:120887829-120887851 CCAGGTCCTTGAGAGGGCCCGGG + Intronic
937984427 2:127632197-127632219 AAAGGCCCCTCAGGGGGCCCTGG - Intronic
938900466 2:135794915-135794937 AGAGGTCCTTCAGGCGGTGCAGG + Intronic
941932178 2:170953162-170953184 AACGGTTCTTCAGGTTGCCCAGG - Intronic
942688881 2:178564002-178564024 AGAGGCCCTTCAGGAGGCCCTGG + Exonic
942689498 2:178570497-178570519 ACAGGTCCTTCAGGTGGCCCTGG + Exonic
942689847 2:178573743-178573765 AAAGGTCCTTCAGGTGGGCCTGG + Exonic
942691862 2:178593840-178593862 ACTGGTCCTACTGGTGGTCCAGG + Exonic
945140940 2:206685618-206685640 ACAGGTCCCTCAGGTGGGTGAGG + Intronic
946726813 2:222669899-222669921 ACAACTCCTCCAAGTGGCCCTGG + Intergenic
947140858 2:227018348-227018370 ACATGGCCTACAGATGGCCCAGG + Intronic
948367870 2:237470152-237470174 ACACGTCCTACAGGTGACCCAGG + Intergenic
948714891 2:239854613-239854635 ACAGGGCCACCAGGTGACCCAGG - Intergenic
948740238 2:240041855-240041877 ACAGGTGTTGAAGGTGGCCCTGG + Exonic
1170434868 20:16315871-16315893 CCAGGTCCTACAGGTGGGGCTGG + Intronic
1171201312 20:23244657-23244679 TCGGGCCCTCCAGGTGGCCCAGG - Intergenic
1171269082 20:23799464-23799486 GCAGGCTCTGCAGGTGGCCCTGG + Intergenic
1171291544 20:23985534-23985556 ACAGGGGCTCCAGATGGCCCAGG + Intronic
1172220671 20:33272652-33272674 CCACGTCCTTCACATGGCCCAGG - Intergenic
1173821124 20:46021539-46021561 TCAGGCCCTTCGGGTGGCACTGG + Intergenic
1175917671 20:62434464-62434486 ACAGGGCCTCCAGGAAGCCCAGG + Intergenic
1176307829 21:5133433-5133455 ACAGGTCGTCCAGGTGCCGCTGG + Exonic
1179708184 21:43194457-43194479 CCCACTCCTTCAGGTGGCCCAGG - Intergenic
1179849232 21:44128597-44128619 ACAGGTCGTCCAGGTGCCGCTGG - Exonic
1179888651 21:44325246-44325268 ACACCTGCTGCAGGTGGCCCAGG - Exonic
1180023116 21:45141874-45141896 ACAGGTGGCTAAGGTGGCCCTGG - Intronic
1180765852 22:18345559-18345581 ACAGGGGCTCCAGATGGCCCAGG - Intergenic
1180780459 22:18516819-18516841 ACAGGGGCTCCAGATGGCCCAGG + Intronic
1180813177 22:18774140-18774162 ACAGGGGCTCCAGATGGCCCAGG + Intergenic
1181199352 22:21208456-21208478 ACAGGGGCTCCAGATGGCCCAGG + Intronic
1181400405 22:22647401-22647423 ACAGGGGCTCCAGATGGCCCAGG - Intronic
1181567882 22:23750913-23750935 ACCTGTCCCTCCGGTGGCCCTGG - Exonic
1181648959 22:24248390-24248412 ACAGGGGCTCCAGATGGCCCAGG + Intergenic
1181702385 22:24628499-24628521 ACAGGGGCTCCAGATGGCCCAGG - Intronic
1184443927 22:44536126-44536148 ACACGGCCATAAGGTGGCCCTGG + Intergenic
1184937559 22:47736082-47736104 CCAGGTACTACAGGTGGGCCAGG + Intergenic
1185030347 22:48439719-48439741 ACAGGCTCTGCGGGTGGCCCTGG - Intergenic
1203227473 22_KI270731v1_random:86450-86472 ACAGGGGCTCCAGATGGCCCAGG - Intergenic
950169683 3:10829632-10829654 AGAGGCTCTTCAGGTTGCCCAGG - Intronic
950481672 3:13248036-13248058 ACAGGTTCTTAAGGTTCCCCTGG + Intergenic
950503111 3:13376878-13376900 CCAGGCCCTTCAGGTGGCGTTGG - Intronic
953723978 3:45381705-45381727 ACAGGCCCTTCAGATGGCATGGG - Intergenic
953786285 3:45914209-45914231 ACAGGTCCTCCAGGTGATGCTGG - Intronic
955510772 3:59678247-59678269 ACAGGCCCTTCTGGTGGCCTGGG + Intergenic
957083514 3:75658614-75658636 CCGGGGCCTGCAGGTGGCCCTGG + Intergenic
961533454 3:127554697-127554719 ACATGTCCTTCCTGTGGCCATGG + Intergenic
961832686 3:129632309-129632331 AAGGGTCCTCCAGGAGGCCCAGG + Intergenic
962318035 3:134370932-134370954 ACGGCTCCTTCAGTTGTCCCTGG - Exonic
962719634 3:138160406-138160428 ACAATCTCTTCAGGTGGCCCAGG + Intergenic
962868996 3:139472036-139472058 ACAGTGCCTTCTGGTGTCCCAGG + Intronic
966895748 3:184443801-184443823 ACATGTCCCCCAGGTGGCTCTGG - Intronic
967951436 3:194844208-194844230 AAAAGCCCTTCAGGTGACCCAGG - Intergenic
972125581 4:35760883-35760905 AAAGGTCCGTCAGTTGCCCCTGG - Intergenic
973714501 4:53662017-53662039 ACAGGGCCTCCAGGGGGCCTGGG - Intronic
976596922 4:86903566-86903588 ACAGCTCCTAAAGGTGGCGCAGG + Intronic
980640037 4:135565683-135565705 ACAGGTCCTTCAATGGACCCTGG - Intergenic
981930593 4:150185178-150185200 ACATGTCCTTCATATGGTCCAGG + Intronic
984845417 4:184104085-184104107 ACAGCTCCCACAGATGGCCCTGG + Intronic
985448027 4:190038302-190038324 CCGGGGCCTGCAGGTGGCCCTGG - Intergenic
987709609 5:21491424-21491446 CCAGCACCTTCAGCTGGCCCTGG - Intergenic
988750004 5:34182742-34182764 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
989625770 5:43428347-43428369 GCAGGCCCTGCAGGAGGCCCAGG - Intergenic
990981121 5:61603091-61603113 ACAGCTGCATCAGGGGGCCCAGG - Intergenic
991738264 5:69645944-69645966 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991759929 5:69910478-69910500 CCAGCACCTTCAGCTGGCCCTGG - Intergenic
991787402 5:70207620-70207642 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991789840 5:70225670-70225692 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991814588 5:70500778-70500800 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991817724 5:70522063-70522085 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991839159 5:70785541-70785563 CCAGCACCTTCAGCTGGCCCTGG - Intergenic
991879848 5:71208005-71208027 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
991882288 5:71226029-71226051 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
992162809 5:74018868-74018890 ACAGTATCTTCATGTGGCCCTGG - Intergenic
992487023 5:77207408-77207430 ACAAGCCATTCAGGTGACCCTGG + Intergenic
992997215 5:82345592-82345614 TGAGGTCCTTCTGCTGGCCCAGG - Intronic
993692392 5:91018317-91018339 ACAGTTCCTTCTGCTGTCCCGGG + Intronic
994421733 5:99532732-99532754 CCAGCACCTTCAGCTGGCCCTGG - Intergenic
994461110 5:100067829-100067851 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
994485259 5:100381273-100381295 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
994730726 5:103487653-103487675 ACAGGTCCTATCGGGGGCCCAGG + Intergenic
996185053 5:120464606-120464628 CCACGTCCTTCAGGTCGCCCAGG - Exonic
998151071 5:139757849-139757871 ACAGGTCCCTCAGCAGCCCCTGG + Intergenic
999422409 5:151456460-151456482 ACAGGTATGTCAGGAGGCCCAGG - Intronic
1000712787 5:164601368-164601390 ACATGTCCAGCAGCTGGCCCAGG + Intergenic
1000757934 5:165184277-165184299 ACTGGTCCTTCAGCTTGCCTGGG - Intergenic
1002559898 5:180073877-180073899 ACAGGCCCTAGATGTGGCCCTGG - Intergenic
1003412326 6:5876555-5876577 ACATGTACTTCATGTTGCCCAGG - Intergenic
1005242933 6:23853525-23853547 TCAGGTCATTCAGGTGGTCATGG - Intergenic
1005475319 6:26202317-26202339 ACTGTTCCTTCAAGTAGCCCTGG - Intergenic
1005548068 6:26889072-26889094 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
1006909939 6:37557291-37557313 ACAGGACGCTCTGGTGGCCCAGG + Intergenic
1007786949 6:44286080-44286102 CCAGCTCCTCCAGGTGGCTCAGG + Exonic
1008514680 6:52307638-52307660 AGAGATCCTTCAGGTGTCCCGGG - Intergenic
1009018828 6:57930166-57930188 CCAGCACCTTCAGCTGGCCCTGG + Intergenic
1009398909 6:63231001-63231023 TCAGGTCATTCAGGTGGTCATGG + Intergenic
1009930023 6:70165965-70165987 ACAGGTGGTCCAGGTGGTCCGGG - Exonic
1012602730 6:101117663-101117685 ACAGGTAGATCAGGTGACCCAGG - Intergenic
1012812651 6:103980713-103980735 ACAAGTGCTTCAGGTGGTTCCGG - Intergenic
1013268989 6:108528388-108528410 ACAGGTCCCTCAAGGGTCCCTGG + Intergenic
1013345650 6:109257693-109257715 ACATGTCCTGCAGCTGGCCCTGG + Intergenic
1013506494 6:110805555-110805577 TCAGGTCCTGCAGTTGGCCCTGG + Intronic
1015057701 6:128923811-128923833 ACAGGTCCATCTGGTGACTCAGG + Intronic
1018206368 6:161440731-161440753 TCAGGACCTTCAGGTGGCATTGG - Intronic
1018442091 6:163822747-163822769 CCAGGTCCTTCAGATGCTCCAGG + Intergenic
1018472700 6:164110755-164110777 ACAGGTCCTGGAGGTTGTCCTGG + Intergenic
1019283093 7:210368-210390 ACAGCTCCTTCACGTAACCCAGG - Intronic
1019577601 7:1744986-1745008 ACAGGTACTCCAGCTTGCCCAGG - Exonic
1019606662 7:1913524-1913546 CCAGGTCCTGGAGATGGCCCTGG + Intronic
1029437018 7:100569159-100569181 TCAGAGCCTTCAGGTGGTCCCGG + Intergenic
1029705020 7:102271566-102271588 AAAGTCCCTGCAGGTGGCCCAGG + Intronic
1030084982 7:105808152-105808174 ACAGGGCCTGCAGGCAGCCCTGG + Intronic
1032408382 7:131674323-131674345 ACAGCTGCTTCTGGTGGCTCTGG + Intergenic
1032542646 7:132716155-132716177 CCAGGGCCTTCAGGTCGCCCAGG - Intronic
1033045522 7:137958744-137958766 AGAGGCTCTTCAGGTGGCCCTGG - Intronic
1034338973 7:150340507-150340529 CCGGGGCCTGCAGGTGGCCCTGG - Exonic
1034423012 7:150999053-150999075 GCTGGTCCTTGAGGTGCCCCTGG + Exonic
1034946366 7:155264736-155264758 TCAGGTCCTTCATGTGGCCTTGG + Intergenic
1037422929 8:18723181-18723203 ACATGTCCTTCATGTGCTCCTGG - Intronic
1038373292 8:27013032-27013054 TCAGGTCATTCAGGTGGTCATGG + Intergenic
1039545711 8:38409703-38409725 AGAGGTCTATCAAGTGGCCCGGG - Intergenic
1045443381 8:102237382-102237404 ACAAGTACTTCAGGTGATCCTGG - Intronic
1050109095 9:2196246-2196268 TCTGTTCCTTCAGGTGGCACTGG - Intergenic
1050653216 9:7795566-7795588 ACAGCTGTTTCTGGTGGCCCTGG - Intergenic
1052413044 9:28147299-28147321 TCAGGTCATTCAGGTGGTCATGG - Intronic
1053279337 9:36807389-36807411 ACAAGCCCTCCAGGTGGCTCAGG - Intergenic
1055784997 9:79862851-79862873 CCAGGTCATTCAGGTGGCAGTGG + Intergenic
1056020565 9:82433795-82433817 TCAGGTCATTCAGGTGGTCATGG + Intergenic
1057071332 9:92103520-92103542 TCAGGTCATTCAGGTGGTCATGG - Intronic
1057200575 9:93137668-93137690 ACAGCTCCTTCAGGTGGGTGGGG - Intergenic
1057262643 9:93594096-93594118 ACAGCTCCTTCAGGGAGGCCTGG - Intronic
1057490915 9:95518717-95518739 ACAGGGCCTTGAAGTGGCCTGGG + Intergenic
1057870838 9:98715924-98715946 ACAGGTACTTCATCTGGCCCTGG + Intergenic
1058251174 9:102697520-102697542 ACACAATCTTCAGGTGGCCCTGG - Intergenic
1059408901 9:114119727-114119749 ACAGGCCCTGCAGGAAGCCCAGG + Intergenic
1060247138 9:121956646-121956668 CCAGGGTCTTCCGGTGGCCCGGG + Intronic
1060992277 9:127856036-127856058 CCAGGCCCTCCAGGTGGCCCAGG - Intergenic
1061116367 9:128615628-128615650 TCAGGTCCTTCAGGCGATCCTGG - Exonic
1185499403 X:585401-585423 GCAGGTGCCACAGGTGGCCCAGG - Intergenic
1192951670 X:76024431-76024453 ACAAGTCCTTCAGGTGACTTTGG - Intergenic
1192963740 X:76155784-76155806 ACAGGTGCACCAGGTGGCCTTGG + Intergenic
1193759956 X:85452572-85452594 AGAGGTTCATCAGGTGGCCTGGG + Intergenic
1201385019 Y:13430688-13430710 ACTGGTCCTTTGGGAGGCCCAGG + Intronic