ID: 942691285

View in Genome Browser
Species Human (GRCh38)
Location 2:178587952-178587974
Sequence GTGTGTGCCCAAAACCAAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 86}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942691285_942691286 -4 Left 942691285 2:178587952-178587974 CCAACTTGGTTTTGGGCACACAC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 942691286 2:178587971-178587993 ACACCCTGAACTCATATTCCTGG 0: 1
1: 0
2: 0
3: 19
4: 159
942691285_942691289 12 Left 942691285 2:178587952-178587974 CCAACTTGGTTTTGGGCACACAC 0: 1
1: 0
2: 1
3: 7
4: 86
Right 942691289 2:178587987-178588009 TTCCTGGTTTTCATCCAAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942691285 Original CRISPR GTGTGTGCCCAAAACCAAGT TGG (reversed) Exonic
902324611 1:15691550-15691572 CTGTCTGCCCAAACCGAAGTGGG - Intronic
902410953 1:16211324-16211346 GTGTGCCCCCAGAAGCAAGTGGG - Intronic
906034240 1:42740758-42740780 GTGTGTGCCAAAAATCAGGGAGG + Intergenic
906165023 1:43679751-43679773 GTGAGTTCCCAAAACAAGGTGGG + Intronic
907595167 1:55713040-55713062 CTGTGTGGGCAGAACCAAGTGGG + Intergenic
908544685 1:65150801-65150823 GAGTGTGCCCAAATCCAGGCTGG - Intronic
910863851 1:91769411-91769433 GTGTGTGCCCAGAGAGAAGTTGG - Intronic
913120044 1:115731586-115731608 CTGTGTGCCAAAAACCAGCTAGG + Intronic
914978203 1:152386923-152386945 CTGTGTGCCCAGAACTAAGTAGG + Intergenic
915686002 1:157635255-157635277 CTGTGTGCCAAACACTAAGTAGG + Intergenic
919740245 1:200976957-200976979 GTGTCTGCCCCAAAACAAATAGG + Intronic
920718679 1:208366680-208366702 GTGTCTGCCCTAAACCAGGGAGG - Intergenic
924657945 1:245990438-245990460 CTGTGTGACCAAAAGGAAGTAGG - Intronic
1073842374 10:107512523-107512545 GTCTGTGGCTAAAAGCAAGTTGG + Intergenic
1074180664 10:111059987-111060009 CTGTGTGCCCATCCCCAAGTGGG + Intergenic
1076759657 10:132596194-132596216 GTTTGTGCCCATCACCCAGTGGG + Intronic
1078660706 11:13283220-13283242 GTATATGCACAAAACCCAGTGGG - Intronic
1078838051 11:15051079-15051101 GTGTGTGCTCAACACGAAATAGG - Intronic
1084654675 11:70508213-70508235 GTGTGTGCCCAGCAGCACGTGGG - Intronic
1090579983 11:128148957-128148979 GTGTGTGCCAAAGCGCAAGTGGG + Intergenic
1092403542 12:8198391-8198413 GTGGTTGAGCAAAACCAAGTGGG + Intergenic
1096996822 12:55843357-55843379 CTTTGTACCCAAGACCAAGTTGG + Intergenic
1100214784 12:92436087-92436109 GTAGGTGCCCAATACCAACTTGG + Intergenic
1100578764 12:95918742-95918764 GTGTGTGCCCCACACCATGATGG - Intronic
1102723239 12:115035745-115035767 GTGGATGCCTAAAGCCAAGTCGG + Intergenic
1105891280 13:24684154-24684176 GTATCTGCCCAAAACTTAGTGGG + Intronic
1108376567 13:49819530-49819552 CTGAGTCCCCAAAACCAAGGAGG + Intergenic
1108951717 13:56102570-56102592 GTTTGTGTCCAAAAAGAAGTAGG + Intergenic
1109955226 13:69557078-69557100 GGGTGTGCCCAAAACAGACTCGG - Intergenic
1110040480 13:70750554-70750576 GTGTGTGCAAAAATCAAAGTAGG - Intergenic
1118374614 14:65165830-65165852 CTGAGTGCTCAAAATCAAGTAGG + Intergenic
1129056696 15:72825604-72825626 GTGTGTGCCCATGTCCGAGTGGG + Intergenic
1130217563 15:81986682-81986704 GTGCATGCCCAGTACCAAGTGGG + Intergenic
1135393590 16:22114321-22114343 GTGTGTACCCCAACCCATGTGGG + Intronic
1138667002 16:58579019-58579041 TTGTAAGCACAAAACCAAGTTGG + Intronic
1141289848 16:82707657-82707679 GGGTGTTACCAAAACCATGTTGG - Intronic
1142678887 17:1533842-1533864 GTATGTGCCGAATGCCAAGTGGG - Intronic
1143519201 17:7436095-7436117 GTGAGTTCCCAAAGGCAAGTAGG - Intronic
1145105445 17:20111680-20111702 GTGTGTCCCCAAAAGCAGGAAGG + Intronic
1149050074 17:52293811-52293833 GTGAGTGCCCAGAACAACGTAGG + Intergenic
1149069692 17:52525251-52525273 GTGTATGCCAAAAAAAAAGTGGG - Intergenic
1149314466 17:55425766-55425788 CTGTGGGCAGAAAACCAAGTAGG - Intergenic
1151336134 17:73440807-73440829 GTGTGTGGCCAATGCCAGGTAGG - Exonic
1157466204 18:47948018-47948040 GTGTGTTCCAAGTACCAAGTAGG + Intergenic
1160390114 18:78523688-78523710 GTGTGTGCCTCAAAGCTAGTGGG + Intergenic
1162256022 19:9490332-9490354 TTGAGTGCCAAAAACCAAGTGGG + Intronic
1167529295 19:50004978-50005000 GAGTGTGACCAAGACCAAGCAGG - Intronic
935289735 2:101600007-101600029 GGGAGTGCCCAAAACCATATAGG - Intergenic
935804654 2:106733719-106733741 GTGAGTGTCCAAAACTTAGTAGG - Intergenic
942689111 2:178566423-178566445 GTCTGTGCCCTCAACAAAGTTGG - Exonic
942691285 2:178587952-178587974 GTGTGTGCCCAAAACCAAGTTGG - Exonic
947063107 2:226189082-226189104 GTGTGGGCAAGAAACCAAGTAGG + Intergenic
948018035 2:234706173-234706195 GTGGATGCCCAAAATCAACTGGG - Intergenic
1179184434 21:39073959-39073981 GGGTGTTCCCAAGGCCAAGTTGG - Intergenic
1181548758 22:23622757-23622779 GTGTGTGCCCACAACCTTTTGGG + Intronic
1183752882 22:39732115-39732137 GTGTGTGCCCCAAAGTAAATAGG - Intergenic
1184108795 22:42383514-42383536 GCGGGGGCCCAGAACCAAGTTGG + Exonic
1185224878 22:49646729-49646751 GTGTGTGCCCATATCCAACATGG + Intronic
954019218 3:47724151-47724173 GTATATGCCCAAAATAAAGTAGG + Intronic
961406477 3:126683225-126683247 GTGAGTGGCCAAAAGCAAGCGGG + Intergenic
965565146 3:170107966-170107988 ATGTGTGCCCAAAAGGTAGTAGG + Intronic
965747655 3:171942337-171942359 GTGTGTGCAGGAAACCAAGGTGG + Intergenic
968648085 4:1749698-1749720 GTGTGTTCCCAGAACCCAGCTGG - Intergenic
972747533 4:41952586-41952608 GTTTGTGCCCAAAACCATGTGGG - Intronic
973998959 4:56491075-56491097 GTGTGTTCCCAAAACTGAGGTGG + Intronic
977265022 4:94843818-94843840 GTGAGTACCCAAAATCAAGGAGG - Intronic
982143597 4:152356892-152356914 TTCTGTGCCCAACACAAAGTAGG - Intronic
985163155 4:187064461-187064483 GTGTGTGCCCATTACCCACTGGG + Intergenic
985383809 4:189424147-189424169 GTGTGTGCACAAACCCACATGGG - Intergenic
986300951 5:6477751-6477773 GTGTAAGCCAAAGACCAAGTGGG + Intronic
996754956 5:126926012-126926034 GTGTGAGCCCAAAAACAAATTGG - Intronic
997139801 5:131366332-131366354 GTCTGTGCCCTTAACCAATTAGG + Intronic
1004541623 6:16555622-16555644 GTGTGTGTCTAAAACCAACTGGG + Intronic
1007723803 6:43902107-43902129 GTGTGTGCCCAAGGCCAGGCAGG + Intergenic
1010759077 6:79701386-79701408 GTGAGTGCCAAGAACCAACTTGG + Exonic
1013000894 6:106021121-106021143 GTGTGTGCACTAAATCAAGTTGG + Intergenic
1013866012 6:114697166-114697188 ATGTGTGCCCAGCACCAAATAGG + Intergenic
1014890850 6:126843985-126844007 TTTTGTGCACAAAACAAAGTTGG + Intergenic
1016546512 6:145229937-145229959 ATTTGTGCCCAAAAGCAAATGGG - Intergenic
1018379002 6:163240646-163240668 GTATGTGCCCAAATCCAAGGAGG - Intronic
1019191600 6:170254389-170254411 GTGTGTGCCAAGAACCAGGTGGG + Intergenic
1021873977 7:25031532-25031554 GTGAGTGCCCTGAACCAAGGTGG + Intergenic
1023659472 7:42457696-42457718 GTGTGTTCCCAAAACGTATTTGG + Intergenic
1029604439 7:101590218-101590240 CTGTGTGTCCAAAGCCCAGTGGG + Intergenic
1030122668 7:106125406-106125428 CTATGTCCGCAAAACCAAGTTGG + Intergenic
1030282378 7:107790319-107790341 GTGGCTGCCCAAAGCCCAGTTGG + Intronic
1033418635 7:141186220-141186242 GTGGGTGCCAAGAACCAAGCAGG + Intronic
1036079613 8:5540665-5540687 GAGTGTGCCCAAGATCAAGGAGG - Intergenic
1057677071 9:97144279-97144301 GTGTAAGTCCAAAACCAAGCAGG + Intergenic
1062359987 9:136183099-136183121 CTGTGTGCCCAGCCCCAAGTAGG + Intergenic
1185600712 X:1336990-1337012 GTGGGTTCCCAAATCCAAGCTGG + Intronic
1187544072 X:20230193-20230215 GTCTGTGCCCAGTACCCAGTTGG - Intronic
1195333640 X:103828768-103828790 ATGTGTGCACATAACCAAATAGG - Intronic
1198775354 X:140173216-140173238 ATGTGAGCCCAAAATCCAGTAGG - Intergenic
1201730868 Y:17201383-17201405 CTGTGTACCAAAGACCAAGTGGG + Intergenic