ID: 942692547

View in Genome Browser
Species Human (GRCh38)
Location 2:178601497-178601519
Sequence GGGGTAGTTGCAGACTTTCA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 125}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942692547_942692551 7 Left 942692547 2:178601497-178601519 CCATGAAAGTCTGCAACTACCCC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 942692551 2:178601527-178601549 ATCACTGACTTTCAGATCTTTGG 0: 1
1: 0
2: 2
3: 43
4: 232
942692547_942692553 11 Left 942692547 2:178601497-178601519 CCATGAAAGTCTGCAACTACCCC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 942692553 2:178601531-178601553 CTGACTTTCAGATCTTTGGGTGG 0: 1
1: 0
2: 0
3: 20
4: 242
942692547_942692552 8 Left 942692547 2:178601497-178601519 CCATGAAAGTCTGCAACTACCCC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 942692552 2:178601528-178601550 TCACTGACTTTCAGATCTTTGGG 0: 1
1: 0
2: 3
3: 17
4: 253
942692547_942692555 17 Left 942692547 2:178601497-178601519 CCATGAAAGTCTGCAACTACCCC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 942692555 2:178601537-178601559 TTCAGATCTTTGGGTGGGCCTGG 0: 1
1: 0
2: 1
3: 18
4: 321
942692547_942692554 12 Left 942692547 2:178601497-178601519 CCATGAAAGTCTGCAACTACCCC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 942692554 2:178601532-178601554 TGACTTTCAGATCTTTGGGTGGG 0: 1
1: 0
2: 1
3: 22
4: 252
942692547_942692556 29 Left 942692547 2:178601497-178601519 CCATGAAAGTCTGCAACTACCCC 0: 1
1: 0
2: 0
3: 7
4: 125
Right 942692556 2:178601549-178601571 GGTGGGCCTGGTACATCTGTTGG 0: 1
1: 0
2: 1
3: 14
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942692547 Original CRISPR GGGGTAGTTGCAGACTTTCA TGG (reversed) Exonic
902715375 1:18269165-18269187 GGGGTGGCTGCAGACTCTGATGG + Intronic
904343456 1:29852965-29852987 CAGGTAGTTGCAGAGTCTCAGGG - Intergenic
905256812 1:36690038-36690060 GGTGCAGCTGCAGACTTTGATGG - Intergenic
906368674 1:45233651-45233673 GGGGTAATTCCAGGCTTCCATGG - Intronic
908443340 1:64177561-64177583 GGGGTTGTTATAGTCTTTCAAGG - Exonic
909619706 1:77653832-77653854 GGGGAATTTGCAGTTTTTCATGG - Intronic
913178517 1:116297479-116297501 GGTGAAGCTGCAGACCTTCACGG + Intergenic
913457231 1:119045741-119045763 GGGGTATTTTCAGACATTTAGGG - Intronic
916491683 1:165307665-165307687 GGGTTAGTTGCAAACTCACATGG - Intronic
919161353 1:193834982-193835004 TGGGTAGTTGAGGTCTTTCAGGG + Intergenic
919414459 1:197290347-197290369 GGGATAGATGCAGAGTCTCAGGG + Intronic
919569912 1:199235305-199235327 GGGGGAGATGGAGACTATCATGG + Intergenic
922978717 1:229806489-229806511 GGGGAAGTTGCACACATGCATGG + Intergenic
1065730489 10:28705587-28705609 GGGGCAGTTGGAGACTCTGAGGG + Intergenic
1066590434 10:36988673-36988695 AGTGAAGTTGCAGACTTTCGTGG + Intergenic
1068911541 10:62383211-62383233 GGGGTACTTGCAGACAGTGAAGG + Intronic
1069181856 10:65370775-65370797 GGGAAACTTGCAGACTTTCTAGG - Intergenic
1072139308 10:92575321-92575343 GGGGTAGATTCAGACTTGGAGGG + Intergenic
1074314725 10:112350684-112350706 AGTGAAGTTGCAGACCTTCACGG - Intergenic
1074513875 10:114146294-114146316 AGGGAAGATGCAGAATTTCAGGG - Intronic
1081325393 11:41738195-41738217 TGAGTACTTGCAGATTTTCAAGG + Intergenic
1086484605 11:87285481-87285503 AGTGTAGCTGCAGACCTTCATGG + Intronic
1087841829 11:102928486-102928508 GGGGCAGCTGCTGTCTTTCATGG - Intergenic
1093289320 12:17301781-17301803 GGGGTGGATGCAGCTTTTCAAGG - Intergenic
1097999721 12:65927050-65927072 GGAGGAGTTGCAGTGTTTCATGG + Intronic
1100135785 12:91551919-91551941 GAGGTTGTTGCAGACTTGTATGG - Intergenic
1102387087 12:112519233-112519255 AGTGAAGCTGCAGACTTTCACGG + Intergenic
1102894291 12:116586258-116586280 GAGGTAGCTGCAGACTTGCATGG + Intergenic
1105722347 13:23128901-23128923 AGTGAAGCTGCAGACTTTCACGG - Intergenic
1106290470 13:28356528-28356550 AGAGTAGTTTCAGACTTTCAGGG + Intronic
1110708663 13:78625761-78625783 GGGGAACTTGTAGACTGTCAGGG - Intronic
1112424668 13:99286936-99286958 GGGGTAGAGGCAGAAATTCAGGG - Intronic
1114527796 14:23377294-23377316 GGGGTAGTTGCAGAGCTCCAGGG + Exonic
1116897704 14:50333415-50333437 TGGGTATTTGTAGACTGTCATGG - Exonic
1117334413 14:54744695-54744717 CTGGGAGTAGCAGACTTTCAGGG - Intronic
1118978481 14:70697653-70697675 GGAATAGTTGGAGACTTTCCTGG + Intergenic
1121280670 14:92695030-92695052 GCGGTGGCTGCAGCCTTTCATGG - Intergenic
1122435155 14:101690256-101690278 AGTGAAGTTGCAGACCTTCATGG - Intergenic
1126117338 15:45220309-45220331 GGGTTAGTTTCAAACTTTCAGGG + Intergenic
1126994710 15:54427846-54427868 GAGGTAGTTTCAGACATGCAGGG - Intronic
1127050092 15:55073302-55073324 GTGGTAGTTTGTGACTTTCAAGG - Intergenic
1128111020 15:65076295-65076317 AGTGAAGCTGCAGACTTTCACGG - Intronic
1130577611 15:85106284-85106306 GGGGAAGTGGCAGATTCTCAAGG - Intronic
1135261970 16:20988975-20988997 AGTGAAGTTGCAGACTTTCGCGG + Intronic
1137272699 16:46912760-46912782 GGGGATGCCGCAGACTTTCAGGG + Intronic
1141052454 16:80783469-80783491 GGGGTGGTTGCTGAGTTCCATGG - Intronic
1146740326 17:35278456-35278478 AGTGAAGCTGCAGACTTTCACGG + Intergenic
1147653653 17:42076285-42076307 AGAGTAGTAGCAAACTTTCAGGG - Intergenic
1152411366 17:80125150-80125172 TGGGTAGCTGGAGACTTTGAGGG - Intergenic
1153407096 18:4753164-4753186 AGTGAAGTTGCAGACCTTCATGG + Intergenic
1154239996 18:12644592-12644614 GGGTTACTTGCAGATTATCAGGG - Intronic
1155344657 18:24846532-24846554 GGGGTAGGTGCCTACCTTCATGG + Intergenic
1155527646 18:26733528-26733550 GGTGTGGTGGCAGACTTGCATGG + Intergenic
1155657790 18:28211314-28211336 GAGATAGTTTTAGACTTTCAAGG + Intergenic
1158420894 18:57292843-57292865 TGGGTATTTGGAGACTTTTAGGG + Intergenic
1159257900 18:65972638-65972660 GGGGTCCTTGCTGAATTTCAAGG + Intergenic
1161379636 19:3958295-3958317 GGGGTCCTCGCAGACCTTCACGG - Intergenic
1165267069 19:34669065-34669087 AGTGAAGCTGCAGACTTTCATGG - Intronic
1167323983 19:48812902-48812924 GGGGGAGCTGCAGTCCTTCAGGG + Intergenic
1167485939 19:49763053-49763075 GGGTTTGTTGCACACTGTCAGGG - Intronic
925057284 2:864959-864981 GGGGATGTGGCTGACTTTCAAGG + Intergenic
927777955 2:25916577-25916599 GGTGAAGCTGCAGACTTTCGCGG - Intergenic
933682757 2:85117498-85117520 GGGGAATTTGCAGTCTCTCAGGG - Intergenic
935187677 2:100748551-100748573 AGGGGAGTTGCAGGCTTGCAGGG - Intergenic
939459756 2:142484663-142484685 GGGATAGTTGAGGACTGTCAAGG - Intergenic
942692547 2:178601497-178601519 GGGGTAGTTGCAGACTTTCATGG - Exonic
945201915 2:207290320-207290342 GGTGTTGTTGCTCACTTTCACGG - Intergenic
946054130 2:216886156-216886178 AGTGAAGCTGCAGACTTTCACGG - Intergenic
1170649645 20:18227725-18227747 GGTGAAGCTGCAGACCTTCACGG - Intergenic
1171238684 20:23548003-23548025 TGGGCTGTTCCAGACTTTCAGGG + Intergenic
1174897406 20:54465293-54465315 ATGGTAGTTGCTGTCTTTCAAGG - Intergenic
1176985020 21:15425788-15425810 GGGGTAGTAAGTGACTTTCAGGG - Intergenic
1184569824 22:45315543-45315565 GGGGCTGCTGCAGACATTCAAGG - Intronic
1185213008 22:49582383-49582405 GGGGTAGTTGGAGCTTTTCCTGG + Intronic
952505925 3:34006813-34006835 GGGGTAGGTGGAGGCTTGCAGGG + Intergenic
952762855 3:36930373-36930395 GGGGTCTTTGCAGACTTTCCCGG + Intronic
954702269 3:52456465-52456487 CGGGTAGTTCCCGACTTTGACGG + Intronic
956459378 3:69455489-69455511 AGGGAAGCTGCAGACCTTCACGG - Intronic
956769164 3:72509907-72509929 GGGGTATTGGCAGACCTACACGG - Intergenic
957009017 3:74984315-74984337 AGTGTAGTTGCAGACCTTCGCGG + Intergenic
962980957 3:140489562-140489584 GGGGTAGTGGAAGGCTTGCATGG + Intronic
972853010 4:43073193-43073215 GGGTTAGGTGCAGACGTTGAGGG + Intergenic
975619311 4:76280267-76280289 GAGTTACTTGCAGACCTTCACGG + Exonic
978311192 4:107386526-107386548 GGGTTAGGAGCAGACTTTGAAGG + Intergenic
978929669 4:114295525-114295547 AGTGAAGTTGCAGACCTTCACGG + Intergenic
979445512 4:120807779-120807801 AGTGAAGCTGCAGACTTTCACGG + Intronic
985712016 5:1434735-1434757 GGGGTAGGAGCATACCTTCAAGG + Intronic
986567505 5:9129336-9129358 GGAGTAGTTGAAGACTTTAAGGG + Intronic
988154880 5:27438640-27438662 GGTGAAGCTGCAGACCTTCACGG + Intergenic
989279804 5:39627877-39627899 TGGGTAAGTGCAGACCTTCACGG + Intergenic
992064445 5:73092781-73092803 GGGATAGGTGCAGACTTGCTTGG - Intergenic
994725194 5:103427181-103427203 AGTGTAGTTTCAGACTTTCTGGG - Intergenic
995336961 5:111010790-111010812 GGGCTGGTGGCAGACTGTCAGGG - Intergenic
995583793 5:113625735-113625757 AGTGAAGCTGCAGACTTTCACGG + Intergenic
997073900 5:130648852-130648874 GGGATAGTTGCTTATTTTCATGG + Intergenic
1000329038 5:160193308-160193330 AGTGAAGCTGCAGACTTTCACGG + Intronic
1001861962 5:175063830-175063852 GAGGTAGTCGCAGCCTTTTAGGG - Intergenic
1004442595 6:15668226-15668248 GGGGTAGTTAGAGAATATCAAGG + Intergenic
1004639038 6:17496164-17496186 GGGGTAGCTTCAGGGTTTCATGG - Intronic
1008231027 6:48984839-48984861 AGTGAAGCTGCAGACTTTCACGG - Intergenic
1012616539 6:101284807-101284829 GGTGAAGTTGCAGAGGTTCAGGG - Intergenic
1013410643 6:109880555-109880577 AGTGAAGCTGCAGACTTTCACGG + Intergenic
1017218780 6:151941676-151941698 AGGCTAGATGAAGACTTTCAAGG - Intronic
1018696046 6:166392651-166392673 AGTGAAGCTGCAGACTTTCACGG + Intergenic
1022760205 7:33340977-33340999 GGTGTACTTGCAGATTTTAAAGG + Intronic
1023703688 7:42917160-42917182 GGAGGATCTGCAGACTTTCACGG - Exonic
1023874696 7:44280489-44280511 GGGGTGGCTGCTGACCTTCACGG + Intronic
1024795793 7:53017905-53017927 AGTGAAGTTGCAGACCTTCAGGG - Intergenic
1026792839 7:73345997-73346019 CAGGTAATTGCAGACCTTCAAGG + Intronic
1027966728 7:85020232-85020254 GGAGGAGTTGCAGATATTCAAGG - Exonic
1029000514 7:97149745-97149767 GGGGTAGTTGCTGAAGTTTAGGG + Intronic
1029234995 7:99108058-99108080 GTGGTTTTTGCATACTTTCAAGG - Intronic
1038847466 8:31243536-31243558 AGTGAAGTTGCAGACCTTCATGG + Intergenic
1040965417 8:53076890-53076912 GGTGAAGCTGCAGACCTTCACGG + Intergenic
1043701261 8:83291301-83291323 AGTGAAGCTGCAGACTTTCACGG - Intergenic
1044534238 8:93341191-93341213 GGGGTATTTGCAGACTCTCTAGG - Intergenic
1047035847 8:120937740-120937762 GGAGTAGTTGCAGAATTACTGGG + Intergenic
1047168630 8:122467378-122467400 GCGGTAGTGGCAGAGTGTCAGGG - Intergenic
1047180289 8:122581291-122581313 GGGGTAGTTGAAGAAGTGCAGGG - Intergenic
1053811846 9:41861348-41861370 AGTGAAGTTGCAGACCTTCACGG + Intergenic
1054618749 9:67326091-67326113 AGTGAAGTTGCAGACCTTCACGG - Intergenic
1055098992 9:72443558-72443580 GTGGTATTTGCAGACTTTTGTGG + Intergenic
1056042191 9:82680010-82680032 TGGGTAGTTGAAGAGATTCAAGG - Intergenic
1186152442 X:6689840-6689862 AGTGAAGCTGCAGACTTTCACGG + Intergenic
1188709099 X:33372166-33372188 GGGGTTTTGGCAGACATTCATGG + Intergenic
1190691949 X:52919794-52919816 GGGGCAGTTGATGACTTTGAAGG + Intergenic
1190694034 X:52935998-52936020 GGGGCAGTTGATGACTTTGAAGG - Intronic
1192251562 X:69417857-69417879 AGTGAAGCTGCAGACTTTCACGG - Intergenic
1194168177 X:90548350-90548372 GGGCTCTTTGCAGGCTTTCAGGG + Intergenic
1198964517 X:142213992-142214014 GGGGTTTTTGCAGACTCTTAGGG + Intergenic
1199748283 X:150790207-150790229 GGGGGAGTGGCTGACTATCAAGG + Intronic
1201278984 Y:12324564-12324586 AGTGAAGTTGCAGACCTTCATGG + Intergenic
1201424392 Y:13832423-13832445 AGTGAAGTTGCAAACTTTCACGG - Intergenic