ID: 942694170 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:178620403-178620425 |
| Sequence | ACAATGTATTCACCTTCATC TGG |
| Strand | + |
| Crispr in exon? | Yes |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 152 | |||
| Summary | {0: 1, 1: 1, 2: 0, 3: 12, 4: 138} |
Found 0 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary |
|---|
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942694170 | Original CRISPR | ACAATGTATTCACCTTCATC TGG | Exonic | ||