ID: 942694170

View in Genome Browser
Species Human (GRCh38)
Location 2:178620403-178620425
Sequence ACAATGTATTCACCTTCATC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942694170 Original CRISPR ACAATGTATTCACCTTCATC TGG Exonic