ID: 942698523

View in Genome Browser
Species Human (GRCh38)
Location 2:178675936-178675958
Sequence GGTCATTCCCAAGAAAGAGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 241}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942698523_942698526 12 Left 942698523 2:178675936-178675958 CCTCCTCTTTCTTGGGAATGACC 0: 1
1: 0
2: 0
3: 9
4: 241
Right 942698526 2:178675971-178675993 GTCACTTTCTTCTTAATTTCAGG 0: 1
1: 0
2: 1
3: 32
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942698523 Original CRISPR GGTCATTCCCAAGAAAGAGG AGG (reversed) Exonic
901488999 1:9586727-9586749 GGATACTCACAAGAAAGAGGAGG + Intergenic
902579103 1:17397161-17397183 GGCCATCCCCAAGAAAGAGCTGG + Intronic
903507620 1:23849451-23849473 GGTCATGCCCCAGAAACATGAGG + Intronic
905469811 1:38183231-38183253 TGACATTTCCAAGAAAGGGGTGG + Intergenic
906529194 1:46513457-46513479 CCTCATTCCCAAGATTGAGGAGG + Exonic
908071424 1:60464616-60464638 GGTGTTACCCAAGAAAGAAGGGG - Intergenic
908171540 1:61510063-61510085 TTTCTTTCCCAGGAAAGAGGTGG - Intergenic
910089274 1:83442834-83442856 GGTCTTCCCAAAAAAAGAGGAGG - Intergenic
912380099 1:109242769-109242791 GGTCAGTGCCAGGAAACAGGAGG - Intergenic
913517775 1:119618958-119618980 TGTAATTCCCAAGAAAGAATGGG + Intergenic
915511909 1:156391200-156391222 GGTCCTTCCCAAGATGGAGCCGG - Intergenic
915521752 1:156449378-156449400 GGTCATTCTCAACAAGGAGGGGG + Intergenic
915934487 1:160082715-160082737 GATCATTCCCAGGAAAGAGAAGG + Intronic
916573443 1:166046944-166046966 TGTTATTTCCAAGACAGAGGAGG + Intergenic
918969729 1:191398154-191398176 GGTCATGCTGATGAAAGAGGTGG - Intergenic
919851359 1:201675123-201675145 GGTCATCCCCAGGTCAGAGGTGG - Intronic
920092594 1:203464997-203465019 GGCCATTCCTAAGACAGAGCAGG - Intergenic
921207681 1:212862369-212862391 GGTCAATCCACAGAAAGAGAAGG - Intronic
921333118 1:214059974-214059996 GGTAAAAACCAAGAAAGAGGAGG + Intergenic
923411184 1:233710946-233710968 TGTCATTCATAAGAAAGGGGGGG + Intergenic
923895483 1:238264898-238264920 GGACATTCTCAAGAAAGTAGAGG + Intergenic
1064207527 10:13336567-13336589 TGTCCTGCACAAGAAAGAGGTGG - Intronic
1065776873 10:29128751-29128773 GGTCATTCCCAATGACTAGGAGG - Intergenic
1065990004 10:30999778-30999800 GGTCATTACCAAGGAAAAGGGGG + Intronic
1067086060 10:43238773-43238795 GGCCCTTCCCATGGAAGAGGGGG - Intronic
1067163161 10:43844003-43844025 GGGCCTGCCAAAGAAAGAGGTGG + Intergenic
1068431245 10:56934955-56934977 GGTCATGCTGATGAAAGAGGTGG - Intergenic
1069646993 10:70007661-70007683 TGTCATTCCCTGGAAAGAGAAGG + Intergenic
1070313644 10:75291841-75291863 GGTCATGTCCAAGGTAGAGGAGG + Intergenic
1070475461 10:76824948-76824970 GGTCATCCCAAAGAGAGTGGGGG - Intergenic
1072196413 10:93120412-93120434 GGTCTTTCTGAAGAGAGAGGAGG + Intergenic
1076654081 10:132010035-132010057 GGTCATTTCCAATAAAGAAAGGG + Intergenic
1076773421 10:132679537-132679559 TGTTATTCCCAAGTAGGAGGAGG + Intronic
1078374973 11:10786011-10786033 GGGCCTTCAGAAGAAAGAGGTGG + Intergenic
1079500193 11:21094255-21094277 GGTCATGCAGATGAAAGAGGTGG + Intronic
1079879062 11:25900629-25900651 GGTCCCTCCCAAGACACAGGAGG + Intergenic
1080661102 11:34296586-34296608 TGACATTGCCAAGAATGAGGTGG + Intronic
1080853949 11:36095343-36095365 GGTCATTGGCAAGAATGTGGAGG - Intronic
1083029564 11:59579644-59579666 TGTCATTCCCAGAAAAGAGAAGG + Intronic
1084252478 11:67911207-67911229 GGTCATTCTGATGTAAGAGGTGG + Intergenic
1085283416 11:75345251-75345273 GGCCAGTCCCAGGAAGGAGGAGG + Intronic
1087004291 11:93453911-93453933 GGTCCTTGCCAAGAGAGAGCAGG - Intergenic
1089397976 11:118148297-118148319 GGTCATGCACAAGAAAGCCGAGG + Intronic
1089652713 11:119924978-119925000 CCTCATTCCCAAGATAGAGTCGG + Intergenic
1089734037 11:120537433-120537455 GTTCATGCCCAATAAAGAGAAGG - Intronic
1090411386 11:126512149-126512171 TGTCAGGCCCAGGAAAGAGGGGG - Intronic
1090428077 11:126624046-126624068 GGTCCTTCCCAAGCCACAGGTGG - Intronic
1090556814 11:127885230-127885252 GGTCATGCTAAAGCAAGAGGTGG + Intergenic
1093042313 12:14396790-14396812 GGTCATAGCAAAGAAAGATGAGG + Intronic
1094133330 12:27098290-27098312 GATCTACCCCAAGAAAGAGGAGG - Intergenic
1095308250 12:40663033-40663055 GGTCATGCTGAAGCAAGAGGTGG - Intergenic
1096634522 12:52949777-52949799 GCTCTTTCCCAGGAGAGAGGGGG + Intronic
1099993491 12:89752287-89752309 TATTATTCCCAAGAAAGGGGAGG - Intergenic
1101789481 12:107914001-107914023 GGAAATTCCCAAGGAAGTGGGGG - Intergenic
1102325743 12:111982009-111982031 GGTGATTACCAAGAACTAGGAGG + Intronic
1103440176 12:120957185-120957207 GGGCATTCCCAGGAAAGGGTTGG + Intergenic
1104088058 12:125493778-125493800 GGCCATTCCCAGGGAGGAGGGGG - Intronic
1104088292 12:125494482-125494504 GGCCATTTCCAGGGAAGAGGGGG - Intronic
1104088581 12:125495348-125495370 GGCCATTTCCAGGGAAGAGGGGG - Intronic
1104588778 12:130068035-130068057 AGTCATTTTCAAGAAAGAGTGGG + Intergenic
1105672685 13:22637059-22637081 TGTTATTGCAAAGAAAGAGGAGG - Intergenic
1105963993 13:25368863-25368885 GGTGATTCCCAAGGAAGGAGAGG - Intergenic
1106251820 13:27987604-27987626 GGACATTCCCAAGCCAGATGGGG + Intronic
1106929893 13:34652572-34652594 GGTCATGCTGATGAAAGAGGTGG - Intergenic
1108248990 13:48546030-48546052 GGACATTCCCATGAATGAAGTGG - Intergenic
1108603766 13:52017029-52017051 GGTCATGCTTAAGCAAGAGGTGG - Intronic
1108828857 13:54452352-54452374 GGTCATGCTGAAGCAAGAGGTGG + Intergenic
1109680656 13:65748132-65748154 GGCCACTCCCAAGATGGAGGCGG + Intergenic
1109823824 13:67692033-67692055 GGTCATGCTAAAGCAAGAGGTGG + Intergenic
1110088857 13:71419039-71419061 GGTCCTTCCCAAGAACCATGGGG - Intergenic
1113512752 13:110869033-110869055 GTTCATTTCCAAGAACCAGGTGG - Intergenic
1114706957 14:24737321-24737343 GGTCATGCTCATGCAAGAGGTGG + Intergenic
1114919463 14:27308346-27308368 GGTCATTTCCAATTAAGAAGGGG + Intergenic
1116286853 14:42985412-42985434 GGTCATGCTGAAGCAAGAGGTGG + Intergenic
1118059396 14:62118252-62118274 GTGCATTCCAAAGAAAGACGGGG + Intergenic
1119654132 14:76404865-76404887 GGTCATTCCCCTTATAGAGGAGG + Intronic
1124159966 15:27259368-27259390 GGACATCCCCAAGACAGAGAAGG - Intronic
1126447294 15:48762525-48762547 TGTTATTTCCAAGAAAGAGATGG - Exonic
1129259023 15:74352933-74352955 GGTCATTTCCAAGTAAGAAAGGG + Intronic
1130115546 15:81001885-81001907 GGCCATGCCCAAGAAGGCGGCGG + Exonic
1133139640 16:3734702-3734724 TGTCATTCGCAGGACAGAGGAGG - Intronic
1133230743 16:4365414-4365436 GGCCTTCCCCAAGAGAGAGGAGG - Intronic
1133443085 16:5836857-5836879 GATCCTTAGCAAGAAAGAGGTGG - Intergenic
1133673642 16:8048509-8048531 TGTCATTCCCAAGGAAGATGAGG + Intergenic
1133805829 16:9125478-9125500 GGTCATTCCCAGGTGAGAAGAGG + Intergenic
1136470378 16:30475525-30475547 GGTCATTCCCAAGTACTTGGAGG - Exonic
1137688171 16:50401536-50401558 GGTCATTCTCAAGGATCAGGAGG + Intergenic
1141878085 16:86840075-86840097 GGTGATTCCCGAGAGAGACGAGG + Intergenic
1143514571 17:7413404-7413426 GGCCAGTGTCAAGAAAGAGGAGG + Intronic
1146931749 17:36782797-36782819 GGACAGTCCCAAGGGAGAGGGGG - Intergenic
1147640473 17:41995157-41995179 TGGCATTCCCTAGAGAGAGGTGG + Intronic
1147640586 17:41996379-41996401 TGGCATTCCCCAGAGAGAGGTGG + Exonic
1147717909 17:42520521-42520543 GGAAATTCCAAGGAAAGAGGGGG - Intronic
1148061997 17:44842979-44843001 GGGCAAGCCCAAGAAGGAGGGGG + Intergenic
1149695941 17:58616164-58616186 GGTCATGACCAAGTAAGTGGGGG - Exonic
1149851648 17:60039883-60039905 GGTCCCTCCCAGGAAAGAGAAGG - Intergenic
1151076911 17:71284333-71284355 GCTCATTTCCAGTAAAGAGGTGG + Intergenic
1151463741 17:74271431-74271453 GGTCATTGCCATGGAAGGGGTGG + Intergenic
1154026330 18:10710448-10710470 GGGCATTCCCAGGTAGGAGGTGG - Intronic
1156656361 18:39293070-39293092 GCTCATTGCCTAGAAATAGGGGG + Intergenic
1156809131 18:41225322-41225344 GGTCATGCCAATGCAAGAGGTGG - Intergenic
1156813607 18:41281832-41281854 GGTCGTTCCCAAGAACTATGTGG - Intergenic
1156960973 18:43030421-43030443 GTTGATGCCCAAGAAAGAAGTGG + Intronic
1159142919 18:64419020-64419042 GGGCAGGACCAAGAAAGAGGAGG + Intergenic
1159643273 18:70888154-70888176 GGTCATGCCAATGCAAGAGGTGG - Intergenic
1160842911 19:1154464-1154486 GGTCATGCCCGAGGGAGAGGCGG - Intronic
1163481883 19:17561429-17561451 GGTCACTTCCAAGAAGCAGGAGG + Intronic
1165197531 19:34116605-34116627 GGGCACTCCCAGGAGAGAGGGGG - Intergenic
1166992130 19:46698958-46698980 AGGCATTCCCAGGAAAGACGTGG + Intronic
1167621744 19:50564610-50564632 GGTCAGTCCCAGGGAAGATGAGG + Intronic
1168024569 19:53634517-53634539 GGTCCTTGCCTTGAAAGAGGAGG - Exonic
924993704 2:338330-338352 GGTCATGCTAATGAAAGAGGTGG - Intergenic
925212613 2:2062844-2062866 AGTATTTCCCAAGAATGAGGGGG + Intronic
925291993 2:2754187-2754209 GGTCATGCTCATGCAAGAGGTGG - Intergenic
926714329 2:15912191-15912213 GCTAATTCTCAAGAAAGTGGAGG + Intergenic
927494463 2:23543298-23543320 TGTGGTCCCCAAGAAAGAGGAGG + Intronic
928103463 2:28452738-28452760 GGCCATTCCTAAGCATGAGGTGG + Intergenic
928594346 2:32845914-32845936 GGTCATGCCAATGCAAGAGGTGG - Intergenic
930496473 2:52151084-52151106 GGTCATTCCCATGACACATGGGG + Intergenic
933423897 2:82086281-82086303 GGTCATTCTGATGCAAGAGGTGG + Intergenic
936786899 2:116104238-116104260 GGCCATACCAAAGAAAGAGGAGG - Intergenic
936986406 2:118315139-118315161 TGCCTTTCCCAAGAAAAAGGAGG + Intergenic
939092003 2:137790761-137790783 GGTCATGCCGATAAAAGAGGTGG + Intergenic
940967893 2:159860516-159860538 GGCCATTTCCCAGGAAGAGGTGG - Intronic
942698523 2:178675936-178675958 GGTCATTCCCAAGAAAGAGGAGG - Exonic
943731898 2:191310707-191310729 GGTTATTCCAAAGTAATAGGAGG + Intronic
943983855 2:194594105-194594127 GTTTATTCCCAGGCAAGAGGGGG - Intergenic
945155688 2:206834926-206834948 GGACATTGAAAAGAAAGAGGAGG + Intergenic
946628823 2:221644496-221644518 GGTCACTCTCAGGAAAGATGAGG + Intergenic
947857946 2:233337109-233337131 AGTCAATCCCAGCAAAGAGGGGG + Intronic
947930487 2:233960835-233960857 AGCCATTCTCCAGAAAGAGGCGG - Exonic
1168975268 20:1961144-1961166 GGTCATCTCCTAGACAGAGGTGG + Intergenic
1169183817 20:3594734-3594756 GGTCAGTCCCCAAAATGAGGAGG + Intronic
1169848440 20:10022476-10022498 AGCCAGTCCCAAGAAAGAGAAGG + Intronic
1172411416 20:34726352-34726374 GGTCTCTACCAAGAGAGAGGGGG + Intronic
1177259457 21:18711526-18711548 GGTCTTTCCCTAGAAACATGGGG - Intergenic
1177271390 21:18852791-18852813 GGTCCTTCCCATGAAAAGGGGGG + Intergenic
1179091314 21:38268641-38268663 GGTCATTCTAATGAGAGAGGCGG + Intronic
1179221102 21:39408358-39408380 GGAATTTACCAAGAAAGAGGAGG + Intronic
1180152887 21:45961054-45961076 GGTCATGCTGATGAAAGAGGTGG + Intergenic
1180393156 22:12303480-12303502 GGTCATGCTGAAGCAAGAGGTGG - Intergenic
1180406593 22:12561288-12561310 GGTCATGCTGAAGCAAGAGGTGG + Intergenic
1181551149 22:23639735-23639757 GGACAGTCCCAAGAAAGGAGAGG - Intergenic
1182034072 22:27183823-27183845 GCTGATTCCCAAGAGACAGGAGG - Intergenic
949880447 3:8656822-8656844 GGTAAATCCCATGGAAGAGGAGG - Intronic
952314395 3:32219968-32219990 GGTCATTCCCAATGAAATGGTGG - Intergenic
952799992 3:37281436-37281458 GATCATTCCCAAGAAAAGAGGGG - Intronic
955037307 3:55281708-55281730 TGTTGTGCCCAAGAAAGAGGTGG + Intergenic
956755588 3:72382961-72382983 GGTTATTACCAAGAAAAATGGGG + Intronic
957105581 3:75883315-75883337 GGTCATGCCAATGCAAGAGGTGG + Intergenic
957411003 3:79839985-79840007 GGTCCTTCCCACGACAGATGTGG + Intergenic
958838438 3:99172951-99172973 GGTCAGCCCCAAGAGATAGGTGG + Intergenic
958866349 3:99506041-99506063 GGTGATTCCCCAGACTGAGGAGG - Intergenic
961183363 3:124893763-124893785 GGTCATTGCCAAGTGTGAGGGGG + Intronic
963150950 3:142044850-142044872 GGTTATTCCCAAGAACACGGAGG - Intronic
963780398 3:149480675-149480697 TGTCATTCCAAGGAATGAGGAGG - Intronic
965493696 3:169371335-169371357 GGTTGTTCCCAAGAACTAGGAGG + Intronic
965506528 3:169521422-169521444 GTCCATTCCCAAGAAAAAGAAGG + Intronic
967328858 3:188270095-188270117 GGTTGTTCGCAGGAAAGAGGTGG + Intronic
967957259 3:194886830-194886852 GGTCATGCTGATGAAAGAGGTGG + Intergenic
969568163 4:7992448-7992470 GGGCATCCCCGAGAAGGAGGTGG + Intronic
974096737 4:57372421-57372443 GGTCCTTGCAAAGAAAGAGAGGG - Intergenic
979125561 4:116968430-116968452 GGTCATTCTGATGCAAGAGGTGG + Intergenic
979139164 4:117150904-117150926 GGTCATTCTGATGCAAGAGGTGG + Intergenic
980242158 4:130191089-130191111 GGTCATGCTCATGCAAGAGGTGG + Intergenic
982062611 4:151619995-151620017 GTTTATTCCCAAGGAAGAGAGGG + Intronic
982161830 4:152578195-152578217 GGTCATTTCAAAGAAATAAGTGG + Intergenic
983528459 4:168784732-168784754 TTACATTCCCAAGTAAGAGGAGG - Intronic
983946407 4:173590736-173590758 GGTCATTCCCATCAGAGAGAAGG + Intergenic
986208652 5:5649487-5649509 GGCCATTGCCAAGCCAGAGGAGG + Intergenic
986557731 5:9027816-9027838 GGTCATGCTGATGAAAGAGGTGG - Intergenic
987659624 5:20855346-20855368 GGTCATGCTCATGCAAGAGGTGG - Intergenic
987940590 5:24531004-24531026 GAACATTCCAAAGAATGAGGAGG - Intronic
988099199 5:26656563-26656585 GGTCATGCTGAAGCAAGAGGTGG + Intergenic
988490726 5:31703018-31703040 GGTCATTCCCAAGAACAAACAGG - Intronic
988740488 5:34064339-34064361 GGCCACTCCCAAGATAGGGGTGG + Intronic
988764020 5:34350301-34350323 GGTCATGCTCATGCAAGAGGTGG + Intergenic
988853271 5:35200037-35200059 GATGATTGCCAAGAAAGAAGAGG + Intronic
990567079 5:57040891-57040913 GGACATTCCCCAGAAAGGGATGG + Intergenic
992670262 5:79053040-79053062 GCTCATTCACTAGAAAGAGCTGG - Intronic
992682582 5:79167627-79167649 GGTTAAGCCCAGGAAAGAGGTGG - Intronic
996260559 5:121462087-121462109 GGTTATTCTCAATAAAGAGTGGG + Intergenic
996834644 5:127777219-127777241 GGTCATGCTAATGAAAGAGGTGG - Intergenic
996897710 5:128504484-128504506 GGTCATGCTGAAGCAAGAGGTGG - Intronic
997751906 5:136354878-136354900 GGTCATTACGAAGAGAGAGTAGG - Intronic
1000352434 5:160362453-160362475 GGGCATTCTCAAGAGAGAGTTGG - Intronic
1002121212 5:177006280-177006302 GGTCCTTCCCAAGGTTGAGGTGG - Exonic
1004284739 6:14310773-14310795 GGTCACTGCAAAGAAAGGGGCGG - Intergenic
1005617840 6:27592449-27592471 GGTAATTCCCCAGACAGAAGCGG - Intergenic
1010248285 6:73682418-73682440 GGTCATGCTGATGAAAGAGGTGG + Intergenic
1010366573 6:75058703-75058725 GGTCATGCTGATGAAAGAGGTGG + Intergenic
1011546798 6:88490535-88490557 GTTCCTTCACAAGAAAGATGGGG - Intergenic
1012490974 6:99782146-99782168 GGTCCTTCCCAAGACACATGGGG - Intergenic
1013701429 6:112774606-112774628 GGAGTTTTCCAAGAAAGAGGTGG - Intergenic
1013904590 6:115199858-115199880 GCTTATTCACAAGAAAGAAGAGG + Intergenic
1015351679 6:132226397-132226419 GGTCATTCCCATGATACATGAGG - Intergenic
1016747100 6:147592360-147592382 GGTCAGTCCAGGGAAAGAGGTGG + Intronic
1018172683 6:161154280-161154302 GGTCCTGGCCAAGAAAGAGCTGG - Exonic
1021949200 7:25757923-25757945 CATCTTTCCCAGGAAAGAGGAGG - Intergenic
1022716705 7:32905480-32905502 GGTCGTTACCAGGAAAGGGGTGG + Intergenic
1023042513 7:36184386-36184408 GACCACTTCCAAGAAAGAGGAGG + Intronic
1023720754 7:43091373-43091395 GATCATTCCCATGGAAGATGGGG - Intergenic
1024298328 7:47864035-47864057 GATCATTCAGAAGAAAGAAGTGG + Intronic
1028359947 7:89955684-89955706 GGTCACACCTATGAAAGAGGTGG + Intergenic
1028624461 7:92862733-92862755 GGTCATGCCGATGCAAGAGGTGG + Intergenic
1029626621 7:101723963-101723985 GGGAATTCCCCAGACAGAGGAGG - Intergenic
1029724921 7:102396474-102396496 CGTCATCCCCAAGAATGCGGCGG + Exonic
1029860083 7:103561702-103561724 GGTCACACCTAAGAAAGAGAGGG + Exonic
1030866878 7:114710835-114710857 GGGCAAACCCAGGAAAGAGGTGG - Intergenic
1032187524 7:129740090-129740112 GGTCATTATGAAGACAGAGGAGG - Intronic
1033450347 7:141456744-141456766 TGTCATTCACCAGAAAGAGTTGG + Intronic
1034301011 7:150015366-150015388 AGACGTCCCCAAGAAAGAGGTGG + Intergenic
1034805041 7:154081936-154081958 AGACGTCCCCAAGAAAGAGGTGG - Intronic
1041746194 8:61211484-61211506 TCTCATTCCGAAGGAAGAGGAGG - Intronic
1042850323 8:73210191-73210213 TGTCATTTTCAAGATAGAGGCGG + Intergenic
1043825351 8:84921985-84922007 GGTCACTCCCAAGAGAGTGTGGG - Intergenic
1044309829 8:90680735-90680757 GGTCATTTCCAATTAAGAAGGGG + Intronic
1045070422 8:98498661-98498683 GTTAATGCCCAAGAAAGATGAGG - Intronic
1045643414 8:104277265-104277287 GGTCATTTCCAATAAAGAAAGGG - Intergenic
1046102688 8:109632820-109632842 TGTCATTACCATGAATGAGGGGG + Intronic
1048189005 8:132271367-132271389 GGTCAGTGCCAAGAAAAAGATGG + Intronic
1048706066 8:137154920-137154942 GGTCACTCCGATGCAAGAGGTGG - Intergenic
1049340059 8:142107330-142107352 GGTCATGCCCTTGAAAGAGAGGG + Intergenic
1049636236 8:143691025-143691047 GGCCATTCCCAAGAAAAAGAAGG - Intronic
1049643507 8:143726028-143726050 GGTCTTCTGCAAGAAAGAGGAGG - Exonic
1050463032 9:5893383-5893405 GCTCTTTCCAAAGAAAGAGCAGG - Intronic
1051015911 9:12475320-12475342 GGTCATTCTGATGAAAGAGGTGG - Intergenic
1051518084 9:17952948-17952970 GGACATTCTGAAGAAGGAGGAGG - Intergenic
1051644227 9:19251459-19251481 GTTAATCCCCAAGACAGAGGGGG - Intronic
1052250345 9:26390507-26390529 GGTCATGCTGAGGAAAGAGGTGG - Intergenic
1055241553 9:74192401-74192423 GTTCATGCCCAAGAGAGAGAAGG + Intergenic
1055384696 9:75748188-75748210 GGTCATGCCTATGCAAGAGGTGG - Intergenic
1056042778 9:82685487-82685509 GGTCATGCTGAAGCAAGAGGTGG + Intergenic
1059195355 9:112366319-112366341 GGTAATTCCCAAGAGAATGGGGG + Intergenic
1059782957 9:117549195-117549217 TGTCCTTCCCAAGATAGATGTGG - Intergenic
1061101895 9:128498455-128498477 GGTGATTGCCAAGAGGGAGGAGG + Exonic
1061418639 9:130461586-130461608 TGTCAACCCCAGGAAAGAGGTGG - Intronic
1185673900 X:1833117-1833139 GGTCATACCCAAGGACTAGGAGG + Intergenic
1186700367 X:12083716-12083738 GGTCATTCAGATGCAAGAGGTGG - Intergenic
1191588168 X:62851423-62851445 GGACATCCCCAAAAAGGAGGTGG - Intergenic
1191668244 X:63725128-63725150 GGTCAGTTCCAAGGAGGAGGAGG - Intronic
1193530593 X:82649985-82650007 GGCCATTCCAAATAAAGAAGGGG - Intergenic
1196334189 X:114511179-114511201 GGTGTTTCCCAAGTAAAAGGTGG + Intergenic
1196493652 X:116297812-116297834 CCTCATTCCCAAGAAAAAAGGGG - Intergenic
1196566010 X:117206258-117206280 GGTCATGCTGAAGCAAGAGGTGG + Intergenic
1197015524 X:121621247-121621269 GGTCATGCTGATGAAAGAGGTGG + Intergenic
1197368853 X:125600863-125600885 GGTAATTCCGATGAAAGGGGTGG - Intergenic
1198294709 X:135274788-135274810 GGTCATTTCCAATAAAGAAAGGG + Intronic
1199044062 X:143147932-143147954 GGTCATGCTGATGAAAGAGGTGG - Intergenic
1199492993 X:148421945-148421967 GGTCATTCCCCAGGAAGAAGGGG - Intergenic
1199909714 X:152272283-152272305 GGTCATGCCGATGCAAGAGGTGG - Intronic