ID: 942700825

View in Genome Browser
Species Human (GRCh38)
Location 2:178707901-178707923
Sequence GCAACAGTGTTACCTGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 97}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942700825_942700827 4 Left 942700825 2:178707901-178707923 CCTCTAACAGGTAACACTGTTGC 0: 1
1: 0
2: 0
3: 2
4: 97
Right 942700827 2:178707928-178707950 GTAGGACAGAATTATGTGCCTGG 0: 1
1: 0
2: 0
3: 6
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942700825 Original CRISPR GCAACAGTGTTACCTGTTAG AGG (reversed) Intronic
905440092 1:37990152-37990174 GCAACAGTGCCACCTGCTGGTGG + Exonic
907625948 1:56029531-56029553 ACAACACTGCTACCTGTTGGTGG + Intergenic
909386915 1:75068231-75068253 GCACCAGAGCTGCCTGTTAGTGG + Intergenic
917160276 1:172049651-172049673 GCACAAGTGTTAACTGTCAGGGG - Intronic
920384382 1:205558483-205558505 GCAATCTTGTTACCTGTTACTGG - Intergenic
921876735 1:220205117-220205139 GCAACAGTTTTTCTTCTTAGTGG + Intronic
923333203 1:232944933-232944955 GCAGCAGTCTTACCTGTTTTGGG - Intergenic
924307267 1:242702953-242702975 CAAGCAGTGTGACCTGTTAGTGG - Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1067778882 10:49183836-49183858 GAAAGAGTGTTACATGTAAGAGG + Intronic
1072606534 10:96988223-96988245 GCAAGATTGTTACCTGTCTGAGG - Intergenic
1081244468 11:40747050-40747072 GCATCAGTGTTAGCTGGTAAAGG - Intronic
1081680207 11:44997214-44997236 GAAACAGTGGTAGCTTTTAGTGG + Intergenic
1082307694 11:50601895-50601917 AAGACAGTGTTACCAGTTAGCGG - Intergenic
1082709935 11:56542455-56542477 TCAACAGTCTTATCTGTTGGTGG + Exonic
1085204972 11:74726148-74726170 GCAGCTCTGTTACCTGTTAAAGG + Intronic
1088557735 11:111079829-111079851 GCGACAGTGTTTCATGTAAGCGG - Intergenic
1092644393 12:10553507-10553529 CCAAAACTGTTACCTGTTACTGG - Intergenic
1103478785 12:121237483-121237505 GCGCCAGTGTCACCTGTGAGTGG - Intergenic
1106041339 13:26096708-26096730 GCAAATGTGTTACCTGAAAGGGG - Intergenic
1106611236 13:31283256-31283278 CCAACAGTGTGAACTTTTAGTGG + Intronic
1107262374 13:38509650-38509672 GGTACAGTGTTACCTGAAAGTGG - Intergenic
1110106373 13:71681782-71681804 GTAGCAGTCTTACCTGTTGGTGG + Exonic
1110407491 13:75167381-75167403 TAAACAGTGGCACCTGTTAGTGG + Intergenic
1112963688 13:105160385-105160407 GAAACAATTTTACCTGTTACAGG - Intergenic
1119469946 14:74889856-74889878 GCTACAAGGCTACCTGTTAGCGG - Intronic
1124546134 15:30628388-30628410 GCAACAGTTTTTCTTGTTAAGGG - Intronic
1132258035 15:100395184-100395206 GAGACAGTGTTGCCTGTTACTGG + Intergenic
1135172391 16:20197304-20197326 TCCTCACTGTTACCTGTTAGAGG + Intergenic
1138734896 16:59238939-59238961 CCAGTAGTTTTACCTGTTAGGGG - Intergenic
1141006349 16:80356527-80356549 GTGACAGTATTAACTGTTAGAGG - Intergenic
1143113439 17:4566925-4566947 GGGACAGAGTTACCTGTGAGGGG + Intergenic
1146493707 17:33301858-33301880 GTAACAGGATTCCCTGTTAGTGG - Intronic
1148196530 17:45717254-45717276 GTAACTGTGTTACCTGTTCCAGG - Intergenic
1152810871 17:82382187-82382209 GCAACAGTGTTAGCCCTTGGTGG + Intergenic
1155817683 18:30334647-30334669 GCACCAGTGTTACCAGTGATGGG + Intergenic
1155917094 18:31567711-31567733 GCAATACTGATACCTGTTAAAGG + Intergenic
1156111627 18:33734017-33734039 GCAAATGTATTACCTGCTAGGGG - Intronic
1160630055 18:80240662-80240684 GCAACAGTGATGCCTGTGTGAGG - Intronic
925003287 2:423169-423191 TCAACAATGTCACCTGTTATGGG - Intergenic
928111779 2:28516561-28516583 GCAAAAGTGTTATCTGGGAGGGG - Intronic
928169447 2:28993986-28994008 GCACCTCTGTTACCTGTCAGGGG + Intronic
928774348 2:34740450-34740472 GAAAAAGTATTACCTGTTATCGG - Intergenic
933788820 2:85867259-85867281 GCATCAGTGTAACCTGGAAGTGG + Intronic
935121216 2:100185182-100185204 GCAACACTGCTGCCTGGTAGAGG - Intergenic
942700825 2:178707901-178707923 GCAACAGTGTTACCTGTTAGAGG - Intronic
942855078 2:180535750-180535772 GCAATAATCTTACCTCTTAGGGG - Intergenic
944836746 2:203587655-203587677 GGAAAAGTGTTTCCTTTTAGGGG + Intergenic
1170681758 20:18532034-18532056 GCAACAGAGTTGCCAGTTGGCGG + Intronic
1172040449 20:32040870-32040892 GAAACAGTCTGACCTGTTTGAGG - Intergenic
1172083563 20:32360565-32360587 GCCAGAGTTTTACTTGTTAGAGG + Intronic
1174737514 20:52979144-52979166 AAAATAGTGTTACATGTTAGAGG - Intronic
1176665929 21:9687699-9687721 GAAACAGTGTTCCAGGTTAGAGG - Intergenic
949753366 3:7379973-7379995 GCTACAGGGTTATCTGTCAGAGG - Intronic
949916631 3:8969517-8969539 GAAACACTGTTTCCTTTTAGTGG - Intergenic
951430193 3:22597521-22597543 GCAACAGTGCAAGCTGTTGGTGG - Intergenic
951654197 3:24986867-24986889 TCAACAGTTTTACCTCTCAGTGG + Intergenic
951999816 3:28772513-28772535 GCACCAGTGTTCCCTGTATGTGG + Intergenic
958827344 3:99047302-99047324 GAAACATTGTTCACTGTTAGTGG + Intergenic
959604445 3:108226867-108226889 GAATCAGTGTTACCTCCTAGTGG + Intergenic
962332184 3:134487976-134487998 GCAACAGAGATACATGTTAAAGG - Intronic
963278035 3:143352286-143352308 GCTACAGTCTTTCCTGTTTGAGG + Intronic
966233781 3:177677786-177677808 GCATCAGTATTATCTGTTACTGG + Intergenic
966680896 3:182641056-182641078 CTAATAGTGTTACCTGTGAGAGG - Intergenic
967597088 3:191338829-191338851 GCAACAGTCTTACTTGTTTAAGG + Intronic
969872547 4:10113844-10113866 GGAACGGTGTTCCCTTTTAGGGG + Intronic
970483836 4:16504721-16504743 GCTGCAGTGTTACCTGTTTGGGG + Intronic
972157741 4:36185621-36185643 ACTACAGTGTTAACTGTTATGGG - Intronic
980770502 4:137365591-137365613 GGTACAGTGTTACCTGAAAGTGG + Intergenic
984044219 4:174777775-174777797 CCAACAGTGTACCCTGTTATTGG - Intronic
995820802 5:116229557-116229579 GCAACACTGTTAGCTGCTAAAGG + Intronic
995983635 5:118140760-118140782 GCTAGAGTGTTACCAGTAAGAGG - Intergenic
1000390359 5:160716896-160716918 GCAAAAGATATACCTGTTAGCGG + Exonic
1005289356 6:24363775-24363797 GAGACAGGGTTACCTCTTAGGGG - Intergenic
1011227443 6:85123238-85123260 AGAACAGTGTTACCTGGAAGAGG + Intergenic
1019416363 7:928612-928634 TCAACACTGTTAGCTGTCAGGGG + Intronic
1024951641 7:54867155-54867177 GCAACAGTGTGACACCTTAGGGG - Intergenic
1027425972 7:78061826-78061848 CCAACAGTGTTAGTTGTTACAGG + Intronic
1028703098 7:93806244-93806266 GCAACAGTGCTATCTGTTAATGG + Intronic
1029309591 7:99650276-99650298 ACCACAGAGTTACATGTTAGGGG + Intronic
1031065034 7:117095590-117095612 TGAGCAGTGTGACCTGTTAGAGG + Intronic
1031644511 7:124207652-124207674 GGTACAGAGTTAACTGTTAGAGG - Intergenic
1035910158 8:3557541-3557563 GGCACAGTGTTTCCTTTTAGAGG + Intronic
1036758753 8:11492086-11492108 GGAACAGTGACACTTGTTAGGGG - Intergenic
1041975483 8:63794558-63794580 GCGACATAGTTACCTGTCAGAGG + Intergenic
1045378638 8:101600782-101600804 GCAACAGTGTGACCAGGGAGAGG + Intronic
1049835629 8:144733855-144733877 GCAACGGTGTTAGCTGTTCCAGG - Intronic
1049981461 9:907906-907928 GCAGAAGTGTTACCTTTTATAGG - Intronic
1050296976 9:4215279-4215301 GCCACAGTTTTGCCTGTGAGGGG + Intronic
1056555525 9:87684292-87684314 GCAACACTGTCACCTGCCAGGGG + Intronic
1057604508 9:96489422-96489444 GAAACAGTGTGACCTGATGGGGG - Intronic
1058972422 9:110095790-110095812 GGAAAAGTGATAGCTGTTAGGGG + Intronic
1203660169 Un_KI270753v1:34062-34084 GAAACAGTGTTCCAGGTTAGAGG + Intergenic
1186422002 X:9433755-9433777 GCCACAGTGTGAACTGTTTGTGG + Intergenic
1188106285 X:26151571-26151593 CCAAAAGTGTTACCTGTAACAGG + Intergenic
1194832045 X:98635183-98635205 GCAACACTGTTCACTGTTGGTGG + Intergenic
1195586744 X:106573751-106573773 GGAACACTTTTACCTGTTGGTGG - Intergenic
1197017750 X:121647898-121647920 CCAACAGTGTTGCCTGTTTTAGG - Intergenic
1199227057 X:145389310-145389332 GCCACAATGTTTCCTTTTAGTGG + Intergenic
1200817376 Y:7547777-7547799 GCAGCAGTGTGACTTCTTAGGGG - Intergenic