ID: 942701769

View in Genome Browser
Species Human (GRCh38)
Location 2:178719340-178719362
Sequence GGCTCAGCCCCGATTTCAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942701769_942701774 14 Left 942701769 2:178719340-178719362 CCAACTGAAATCGGGGCTGAGCC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 942701774 2:178719377-178719399 CCAAAACAACTGAGGCCCCCAGG 0: 1
1: 0
2: 0
3: 7
4: 130
942701769_942701772 6 Left 942701769 2:178719340-178719362 CCAACTGAAATCGGGGCTGAGCC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 942701772 2:178719369-178719391 TCGGCACTCCAAAACAACTGAGG 0: 1
1: 0
2: 0
3: 3
4: 56
942701769_942701775 18 Left 942701769 2:178719340-178719362 CCAACTGAAATCGGGGCTGAGCC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 942701775 2:178719381-178719403 AACAACTGAGGCCCCCAGGATGG 0: 1
1: 0
2: 1
3: 21
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942701769 Original CRISPR GGCTCAGCCCCGATTTCAGT TGG (reversed) Exonic
900726573 1:4220206-4220228 GGCTCTGCCCCCTTTTTAGTAGG + Intergenic
901455986 1:9363083-9363105 TGCCCAGCCCCCATTTCAGCTGG - Intronic
904169613 1:28582205-28582227 GGCTCCGCTCCGAGCTCAGTGGG + Intergenic
908181659 1:61611939-61611961 GCTTCAGCCCCAGTTTCAGTTGG - Intergenic
920702596 1:208229074-208229096 GGCTCAGCCCCGCATTCTCTGGG + Intronic
1063132237 10:3188413-3188435 GGCTCAGCCACGATTCCACCAGG - Intergenic
1063910851 10:10828865-10828887 GGCTCAGCATCACTTTCAGTGGG - Intergenic
1063996892 10:11628142-11628164 GGCTCAGCAACGATTCCAGATGG - Intergenic
1064318291 10:14278010-14278032 AGCTCAGGCCAGATGTCAGTTGG - Intronic
1069943191 10:71969341-71969363 GGGACAGCCACGTTTTCAGTCGG + Intronic
1073911946 10:108356196-108356218 GGATGAGCCGAGATTTCAGTTGG - Intergenic
1076127194 10:127984377-127984399 GGCCCTGCCTCCATTTCAGTGGG + Intronic
1076745281 10:132509819-132509841 GGCTCAGCCCCAAGCTCAGGAGG - Intergenic
1077924514 11:6667626-6667648 GCCTCAGCCCCTATTTAAGAAGG - Intergenic
1078663544 11:13306226-13306248 GGCTCAGCCCTGACAGCAGTGGG + Intronic
1084745203 11:71165711-71165733 GGCTGAGCCCCTGTTTCACTTGG - Intronic
1088585303 11:111355780-111355802 ACCTCAGCCCGGATTTCAGGAGG - Intronic
1090898971 11:131008542-131008564 GGCTGAGCCTTGTTTTCAGTTGG + Intergenic
1093508354 12:19896403-19896425 GGCTCAACCCTGATTGGAGTGGG + Intergenic
1094423500 12:30296322-30296344 GGCTCAGCACTGATCTCAGGTGG - Intergenic
1100671789 12:96821387-96821409 GGCACACCCACCATTTCAGTTGG - Intronic
1110714725 13:78688878-78688900 GGCTCATTCCTGATTTCAATGGG + Intergenic
1122540507 14:102495472-102495494 GGCTAAGCCCCCATTCCAGGGGG + Intronic
1123201247 14:106666514-106666536 GGCTCAGCCCAGACTTCATATGG + Intergenic
1134795733 16:17034967-17034989 GGGCCAGCCCAGATTTCACTGGG + Intergenic
1135666482 16:24339847-24339869 ATCTCAGTCCTGATTTCAGTAGG + Intronic
1137305231 16:47192456-47192478 AGCTCAGGCCCTATTTCAGAAGG - Intronic
1137942826 16:52705532-52705554 GGCTCAGCTGTGATTTCAGAGGG + Intergenic
1138837263 16:60453341-60453363 GCCTCAGCCCCAATATCACTAGG - Intergenic
1140719178 16:77755420-77755442 GGCTCAGCCCCCATGTGAATCGG - Intergenic
1142941357 17:3382265-3382287 GGCTCAGCCCTGCATCCAGTAGG + Intergenic
1149611758 17:57962584-57962606 GGCTCAGCCCTGCTTCCAGGAGG - Intergenic
1150010333 17:61496910-61496932 GGCTCAGCTCCGATTCCTGCAGG + Intergenic
1150265782 17:63831629-63831651 GCCTCTGCCCTGTTTTCAGTGGG - Intronic
1151713417 17:75819350-75819372 GTCTCAGCCCCGGGATCAGTGGG - Intronic
1157308759 18:46536301-46536323 GGCTCAGCCACTATCTCAGGAGG - Intronic
1157471112 18:47989707-47989729 GGCTCAGCCCCCATCTCTGTGGG - Intergenic
1161504875 19:4638624-4638646 GGTCCAGCCTCGATTTCCGTAGG - Intergenic
925705145 2:6677569-6677591 GGCCCAGCCCCCTTTTCAGGAGG - Intergenic
926143099 2:10380300-10380322 GGCTCAGCCCCCATCTTAGTGGG + Intronic
928297086 2:30092932-30092954 GACTCTGCCCCGACTTCTGTGGG - Intergenic
931287932 2:60848285-60848307 GTCTCAGCACCGATTTCTCTAGG - Intergenic
940423901 2:153509302-153509324 AGCCCCGCCCCGTTTTCAGTTGG - Intergenic
942701769 2:178719340-178719362 GGCTCAGCCCCGATTTCAGTTGG - Exonic
948121085 2:235530932-235530954 GGCTCAGCCCCAATGACAGCAGG - Intronic
1175424052 20:58853320-58853342 GGCTGTTCCCCGATTTCAGGGGG - Exonic
953741784 3:45544881-45544903 GGCTCAGCCCGGGTCTCTGTGGG - Intronic
960999775 3:123366418-123366440 AGCTCAGGGCCGATTTCAGATGG + Intronic
966734950 3:183180810-183180832 GTCTCAGCCCCCTTTACAGTTGG + Intronic
967171419 3:186825884-186825906 GTCTCAGCCCCCTTTACAGTTGG - Intergenic
967997129 3:195175123-195175145 GGCACAGCCCCGATTGCTCTGGG - Intronic
973595830 4:52488941-52488963 GGCTAAGCCAGGATTTTAGTAGG + Intergenic
979602318 4:122599984-122600006 GGCTCAGCAGAGATTTCAGCTGG - Intergenic
986397742 5:7346953-7346975 TACTCAGCCCAGAGTTCAGTGGG - Intergenic
988153262 5:27415306-27415328 GGCACAACCCCCATTTAAGTAGG - Intergenic
990128673 5:52551728-52551750 GGCCCAGCCCAGATTCAAGTGGG + Intergenic
1001243584 5:170088651-170088673 GGCTCAGCCAAGGTTCCAGTGGG - Intergenic
1010824144 6:80452224-80452246 GGACCAAGCCCGATTTCAGTGGG + Intergenic
1011805102 6:91062533-91062555 GGCACAGCCTTGATTTTAGTGGG + Intergenic
1015347270 6:132174901-132174923 GCCTCAGCCTAGATTTCAGAGGG - Intergenic
1015986825 6:138892995-138893017 GGCTCAGACCCTATTTAAGAAGG - Intronic
1027345843 7:77258626-77258648 GGCTAAGCTATGATTTCAGTAGG + Intronic
1033798123 7:144871481-144871503 GGCTGGGCCCCTAATTCAGTAGG - Intergenic
1034449769 7:151131033-151131055 GGCTCAGCCCAGAGTTCTGTCGG - Intronic
1036752873 8:11454458-11454480 GGCACAGCCCTGATTTCAACCGG + Intronic
1041392533 8:57359721-57359743 GCCTCTGCCCAGATTTCAGAGGG + Intergenic
1042390634 8:68229708-68229730 GGCTCAGCCCAGATCTCATGGGG + Intronic
1050207773 9:3215300-3215322 GGCTCAGCCATGATGTCAGCTGG + Intergenic
1055738145 9:79355489-79355511 GGCTCAGCCTCCATTTCTGAAGG + Intergenic
1055744465 9:79427370-79427392 GGCTTAGAGCTGATTTCAGTGGG + Intergenic
1197795451 X:130293146-130293168 GGGTCAGCCACGATCTCAGGAGG + Intergenic
1201148818 Y:11083338-11083360 GGCTGAGCCCCTGTTTCACTTGG - Intergenic