ID: 942701792

View in Genome Browser
Species Human (GRCh38)
Location 2:178719502-178719524
Sequence CAATATTTCCAGGGGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 247
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 232}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942701792_942701800 21 Left 942701792 2:178719502-178719524 CCCTCCACCCCCTGGAAATATTG 0: 1
1: 0
2: 0
3: 14
4: 232
Right 942701800 2:178719546-178719568 CTACTCACCAGAAACATGGACGG 0: 1
1: 0
2: 0
3: 12
4: 194
942701792_942701799 17 Left 942701792 2:178719502-178719524 CCCTCCACCCCCTGGAAATATTG 0: 1
1: 0
2: 0
3: 14
4: 232
Right 942701799 2:178719542-178719564 CATTCTACTCACCAGAAACATGG 0: 1
1: 0
2: 2
3: 19
4: 337

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942701792 Original CRISPR CAATATTTCCAGGGGGTGGA GGG (reversed) Intronic
902237446 1:15066656-15066678 CTATTTTTCCATGGGGTGGGCGG + Intronic
903043432 1:20549246-20549268 CAATTTTTCCATGGAGGGGAGGG - Intergenic
903312662 1:22471983-22472005 GAATAATTCCAGGGGCTGGCTGG + Intronic
909592406 1:77365526-77365548 CAATTTTTCCATGGGGTTGGGGG + Intronic
910166563 1:84334375-84334397 AAATATTTCTATGGGGTTGATGG + Intronic
911566720 1:99471137-99471159 CAACATTTCCACGTGCTGGAGGG - Intergenic
912418439 1:109527759-109527781 CAAAATGTCCATGGGATGGAGGG - Intergenic
915019395 1:152764965-152764987 CAATATTTTGAGGGAGTGAATGG - Intronic
915404676 1:155650669-155650691 AAATATTTACAGGAGGTAGAGGG + Intergenic
916552832 1:165865396-165865418 CATGCTTTGCAGGGGGTGGAGGG - Intronic
923199567 1:231698342-231698364 CGAGATTTCCAGGGGTTGCATGG + Intronic
923741863 1:236662244-236662266 CACTATTGCCAGGGGGTTGTGGG + Intergenic
924195671 1:241604484-241604506 CAATTTTTCCTGGGCCTGGAGGG - Exonic
1065226555 10:23549341-23549363 CAATTTTTCCATGGGCTGGGGGG - Intergenic
1065454555 10:25893339-25893361 CAACCTTTACAGGGGATGGAAGG - Intergenic
1066701994 10:38139741-38139763 CAATATTTTCAGAGGCTTGAAGG - Intergenic
1067226936 10:44382691-44382713 GGATAATCCCAGGGGGTGGAGGG - Intronic
1067790194 10:49281935-49281957 CAATGTATCCTGGAGGTGGAGGG - Intergenic
1068015996 10:51516793-51516815 CTATATTTCCAGTGCTTGGAAGG - Intronic
1068630280 10:59290855-59290877 CAGTATTTGCAGGGGGGGCAGGG + Intronic
1069215212 10:65811609-65811631 CAAAACTTCCATGGTGTGGAAGG + Intergenic
1069387151 10:67894115-67894137 CAAAAGTTACATGGGGTGGAGGG - Intronic
1071961831 10:90814748-90814770 CAACATTACCAAGGGCTGGATGG + Intronic
1072021960 10:91410778-91410800 CAACATTTCCCGAGGGTGGTAGG - Intronic
1073901110 10:108222092-108222114 CAAAATTTGCAAGGGGTAGAAGG - Intergenic
1075433711 10:122415097-122415119 CTATATTTCCATGGTATGGATGG - Intronic
1075613179 10:123869973-123869995 AAATCTGTCCAGGGGGTGGGGGG + Intronic
1076749138 10:132533536-132533558 CAATATTTCAAGGGTGAAGAAGG + Intergenic
1076934331 10:133557306-133557328 CAATACTTCCAGGGGGCAAATGG - Intronic
1077259589 11:1608773-1608795 CACCAATGCCAGGGGGTGGAGGG - Intergenic
1077388126 11:2284836-2284858 TAATATTTCAAAGGCGTGGAAGG - Intergenic
1078375932 11:10792989-10793011 AAATATGTCCAGGGGCTGGTTGG + Intergenic
1078442621 11:11379771-11379793 CCATCTTTCCAGGAAGTGGATGG + Intronic
1079894655 11:26103101-26103123 CAATATTTCTAGTGGGTTGGGGG + Intergenic
1080034674 11:27699741-27699763 GAATCCTTCCAGGGGGTGGGTGG - Intronic
1082611808 11:55308447-55308469 CAAAATTAGCAGGGGGTGGGGGG + Intergenic
1082988919 11:59190621-59190643 CAATCTTTCCTGGCTGTGGATGG - Intronic
1084154222 11:67304583-67304605 CAATATTGCCAAGGGGCCGAGGG + Intronic
1084800017 11:71537646-71537668 CACCAATGCCAGGGGGTGGAGGG + Intronic
1085263262 11:75220719-75220741 CCAAATTGCCAGGGAGTGGAAGG + Intergenic
1086267904 11:85024125-85024147 CATTAATTTCAGGGGGTTGATGG + Intronic
1087756338 11:102058169-102058191 CAAAATGTTCCGGGGGTGGAGGG - Intronic
1088042537 11:105405074-105405096 CAACATTTCCAGAGAGGGGAAGG + Intergenic
1089312229 11:117566230-117566252 CAATTTATGCAGAGGGTGGAGGG - Intronic
1089463029 11:118663852-118663874 GAACATTTCCAGGCGGTGTATGG + Intronic
1092292112 12:7166602-7166624 CAATTTTTCCAGAGACTGGAGGG - Intergenic
1092325455 12:7527159-7527181 CAATATCTCCAGGGACAGGAAGG - Intergenic
1094502045 12:31030461-31030483 CACTCTTTCCAGGGTGTGCAGGG - Intergenic
1094502117 12:31030992-31031014 CACTCTTTCCAGGGTGTGCAGGG - Intergenic
1097224244 12:57467741-57467763 CCATAAATCCAGGGGTTGGAGGG - Intronic
1097235898 12:57539415-57539437 CAAGATTCACAGGGGTTGGAGGG + Intronic
1101789031 12:107911524-107911546 CATTAGTCCCAGAGGGTGGAGGG + Intergenic
1102219336 12:111183808-111183830 AAATATCTGCAGGGGGTGGTGGG - Intronic
1102889464 12:116547181-116547203 CACTATTTCCTGGGAGTGCAGGG + Intergenic
1109792180 13:67263622-67263644 CAATAGTTCTAGGGGGGGGGAGG - Intergenic
1110325239 13:74206533-74206555 CCCAATTTCCTGGGGGTGGATGG - Intergenic
1110466826 13:75812042-75812064 AAATGTCTCCTGGGGGTGGAGGG - Intronic
1112025509 13:95407527-95407549 CAGTTTTTCCAGGGCTTGGAAGG - Intergenic
1112353915 13:98659002-98659024 CAATTTTTCCATGGCGGGGATGG + Intergenic
1113404292 13:110023605-110023627 CAATAATTCCATGGTGGGGAGGG - Intergenic
1113448271 13:110387306-110387328 CACTATTTCCAAAGGCTGGAAGG + Intronic
1116794348 14:49373948-49373970 CTACATTTTCAGGGGGTGGGGGG - Intergenic
1117779077 14:59213715-59213737 CACTATTTACGGTGGGTGGAGGG + Intronic
1119225765 14:72943578-72943600 CATCATTTGCAGGGGGTGAAAGG + Intronic
1119624582 14:76161593-76161615 CAAAATTGCCAGGGGGAGCAGGG - Intronic
1119770250 14:77216200-77216222 CAATGTTTCCAGGAGGAGGGAGG - Intronic
1120423916 14:84322979-84323001 CAATGTTTCCAGGAAGGGGATGG + Intergenic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1122628371 14:103096004-103096026 CCTTATTTGCAGGGGCTGGAAGG + Intergenic
1123974858 15:25543608-25543630 GAATTTTCCCAGGGGGTGGAAGG - Intergenic
1124842512 15:33256876-33256898 CAATTTTTCCACGGGGTGCAAGG + Intergenic
1125006942 15:34827336-34827358 AAATATTTGCAGGGGGTAGGGGG + Intergenic
1125696985 15:41646709-41646731 CATTTTTTCCAGGGGGCGGGGGG - Intronic
1125925389 15:43558883-43558905 CAGTGTTTCCAGAGGGTAGATGG + Exonic
1127674790 15:61228878-61228900 CAACATTTCTGGGGGGCGGAGGG + Intronic
1130614772 15:85394626-85394648 CCATTTTACCAGGGGGTGGGAGG - Intronic
1131410877 15:92207486-92207508 CAAAACTTCCATGGTGTGGAAGG - Intergenic
1131659736 15:94501029-94501051 CATTGTTTCCAGGGGCTAGAGGG - Intergenic
1132065492 15:98727653-98727675 CATTATACCCAGGGGCTGGAGGG + Intronic
1132209074 15:100007232-100007254 CACAATGTCCAGGAGGTGGAGGG + Intronic
1133137119 16:3719875-3719897 CCTCATTTCCAAGGGGTGGAGGG + Intergenic
1134853165 16:17498527-17498549 GAATAATTCCAGGAGGTAGAGGG + Intergenic
1135605877 16:23824209-23824231 AAAGATTGCCTGGGGGTGGAGGG + Intergenic
1135658020 16:24268487-24268509 CAATATCTCCAGTGGTTGAATGG - Intronic
1135793459 16:25419938-25419960 CTAAATTCCCAGGGAGTGGAGGG - Intergenic
1135830562 16:25769195-25769217 CAAGATTTGTTGGGGGTGGAAGG + Intronic
1137458543 16:48637108-48637130 CCATGCTTCCAGGAGGTGGATGG + Intergenic
1138108326 16:54303742-54303764 CATGACTTTCAGGGGGTGGATGG + Intergenic
1138925627 16:61587395-61587417 CCATCTTTCCATGGAGTGGATGG + Intergenic
1139733398 16:68967189-68967211 CAATATTTCCATGGACGGGACGG + Intronic
1140748339 16:78000639-78000661 CAAAACTTCCATGGCGTGGAAGG - Intergenic
1140941400 16:79724764-79724786 CAAGATCTCCAGGTGGTGGAAGG - Intergenic
1142694148 17:1624016-1624038 GTATAATTCCAGGGGGTGGTCGG - Intronic
1143265122 17:5630799-5630821 CAACATTTCCAGGAGCTGGAGGG + Intergenic
1143796585 17:9342033-9342055 CAATTTTTCCACGGCCTGGAGGG + Intronic
1144252481 17:13431704-13431726 CAATATTTGCTGGGGGCGTAAGG + Intergenic
1144702655 17:17349124-17349146 CAATGTTTTCAGGGTGTGGCTGG - Intergenic
1147537972 17:41333268-41333290 CAATGTTTGCAGGAGGTGGTGGG + Intergenic
1148912083 17:50948282-50948304 CAATATTTGCAGGAGGGGGAAGG - Intergenic
1150168990 17:62971902-62971924 CAATTTTTCCAGAGGGTAGGGGG - Intergenic
1151032107 17:70753328-70753350 CAATTTTTCCATGGGGTTGGGGG - Intergenic
1151463141 17:74267445-74267467 CAAAACTTCCACAGGGTGGAAGG - Intergenic
1152110970 17:78357706-78357728 CAACATTTGGAGGGGATGGATGG - Exonic
1155369323 18:25081118-25081140 GAACATTTCCAGGGGGTGGGAGG + Intronic
1156018279 18:32570685-32570707 CAACATTTCTAGTGGGTGGTGGG - Intergenic
1156261343 18:35447130-35447152 GAATAATTCCAGGGGCTGCATGG - Intronic
1157785044 18:50474178-50474200 CAAAATGACCAGTGGGTGGATGG + Intergenic
1159021320 18:63145383-63145405 CAAGAGATCCAGGGGGTGGGGGG + Intronic
1159085736 18:63789465-63789487 AAATAATTCCATGGAGTGGAAGG + Intronic
1161872380 19:6880150-6880172 CAATATCACCAGGGGATGGGAGG + Intergenic
1167802479 19:51753634-51753656 CAATTTCTCCATGGGGTGGCGGG - Intronic
925086330 2:1110487-1110509 CAATATTTACATGGGAGGGAGGG - Intronic
925943440 2:8840172-8840194 AAATATTTCCAGGAGGGGGCCGG - Intergenic
926910797 2:17850967-17850989 CACCATTTCCAGGGGTGGGAGGG + Intergenic
929333697 2:40714329-40714351 GAATTTTATCAGGGGGTGGAGGG - Intergenic
930053711 2:47236332-47236354 CAATATCTCCAGGGGTGAGAAGG + Intergenic
932209217 2:69914129-69914151 CATCACTTCCCGGGGGTGGAGGG + Intronic
932250913 2:70242877-70242899 CAATTTTTCCATGGGCGGGATGG - Intronic
932783343 2:74577924-74577946 CAATTTTTCCATGGGGTGGTGGG + Intronic
933556092 2:83832435-83832457 GAATGTTACCAGGGGCTGGATGG - Intergenic
933973004 2:87485428-87485450 TAAAATTTGTAGGGGGTGGAGGG - Intergenic
935760978 2:106320409-106320431 CAAAGCTTCCAGGGTGTGGAAGG + Intergenic
936249381 2:110855875-110855897 CAAAGTTTCCACAGGGTGGAAGG + Intronic
936320717 2:111464785-111464807 TAAAATTTGTAGGGGGTGGAGGG + Intergenic
936614516 2:114034794-114034816 TAATGTTCCCAGGGGCTGGAGGG - Intergenic
937283645 2:120736625-120736647 CTGTTTTTTCAGGGGGTGGAGGG + Intronic
939627681 2:144498254-144498276 AAATATTTCAAGGGGTAGGAAGG + Intronic
941350645 2:164429840-164429862 AAATAACTGCAGGGGGTGGACGG + Intergenic
942032212 2:171973779-171973801 CAATATTTCCCTGGGGATGAGGG - Intronic
942550516 2:177111232-177111254 AAAGATTTCCAGGAGCTGGAAGG + Intergenic
942701792 2:178719502-178719524 CAATATTTCCAGGGGGTGGAGGG - Intronic
943759548 2:191593191-191593213 AAAAATCTCCAGGGGGTGGCCGG + Intergenic
946883160 2:224196180-224196202 CAGTATTCCCAGGGGGTCAAAGG + Intergenic
947049779 2:226029572-226029594 AAATATTTACAAGGGCTGGATGG + Intergenic
947549988 2:231038574-231038596 GAAAGTTTCAAGGGGGTGGATGG + Intronic
948420343 2:237856134-237856156 CAATTTTTCCATGGGGTGAGAGG + Intergenic
1169224240 20:3846513-3846535 CAAAGTTCCCAGGGGGAGGAGGG + Intergenic
1169281425 20:4270435-4270457 GAATATTTGAAGAGGGTGGAGGG - Intergenic
1170703421 20:18724737-18724759 AAATCTTTCCAGGGGAGGGAAGG - Intronic
1171127067 20:22611577-22611599 CAATATTTCCAGGACCTGAATGG + Intergenic
1174194515 20:48763594-48763616 CAATTGTTCCTGGGGCTGGAGGG + Intronic
1175009486 20:55720763-55720785 CAATGTGCCCAGGGTGTGGAGGG + Intergenic
1175457704 20:59127762-59127784 AAATGCTTCCTGGGGGTGGAGGG - Intergenic
1175484908 20:59338898-59338920 AAATATTTCCATTGAGTGGAGGG - Intergenic
1175487940 20:59358733-59358755 AAATATTTCCATTGAGTGGAGGG + Intergenic
1175677398 20:60958540-60958562 AAGTATTTCCAGGAGATGGAAGG + Intergenic
1177075857 21:16572699-16572721 CAATATTTTTGGGGGGTGGGGGG + Intergenic
1177183461 21:17768161-17768183 CAATCTCTCTAGAGGGTGGAAGG + Intergenic
1179602100 21:42486113-42486135 CAAGAGTCCCAGGGAGTGGAGGG - Intronic
949589296 3:5476583-5476605 CACTATTTCCAGGAGGTGCCTGG - Intergenic
951106546 3:18750575-18750597 CAATAGTTACAATGGGTGGAAGG + Intergenic
951119752 3:18911766-18911788 CAATACTTCCAAGAGATGGAAGG + Intergenic
951415595 3:22418022-22418044 CAATGCTTCCACGGTGTGGAAGG - Intergenic
951579054 3:24142926-24142948 CAATATTGCAAGGGTCTGGAAGG + Intronic
953203222 3:40796614-40796636 GAATATTGGCAGGGGGTGGAGGG - Intergenic
953462244 3:43090735-43090757 CTGTCTTACCAGGGGGTGGAAGG + Intronic
954491818 3:50913615-50913637 CAACAATTCCAGTGGTTGGAAGG - Intronic
954692091 3:52401051-52401073 CAGTATTTACAGGGGCTAGAGGG + Exonic
956013576 3:64857743-64857765 CAAAATGTGCATGGGGTGGAAGG + Intergenic
956392044 3:68784668-68784690 CAAAGTTTCCACAGGGTGGAAGG + Intronic
956972065 3:74537798-74537820 CAATATTTCCCAGAGATGGAGGG + Intergenic
958488039 3:94736896-94736918 CAATATTTCCAGCAGGAAGATGG - Intergenic
961590211 3:127973933-127973955 CAATTTCTCCAGGGTGTGGCTGG - Intronic
962805256 3:138922437-138922459 CAATTTTTCATGGGGGTGGGGGG + Intergenic
964481435 3:157142554-157142576 CACAATTAACAGGGGGTGGAGGG + Intergenic
964871368 3:161316894-161316916 GAAGATTTCCTGGGGTTGGAAGG + Intergenic
970565260 4:17325912-17325934 CAAAAGTTCCAGGAGGAGGAAGG + Intergenic
971614960 4:28776976-28776998 AATTGTTTCCAGGGGTTGGAGGG + Intergenic
972645547 4:40964659-40964681 CATTGTTTCCAGTGGCTGGATGG - Intronic
972916171 4:43882805-43882827 CACTTTTTCCATGGGGTGGTGGG - Intergenic
973037607 4:45425842-45425864 CAATTTTTCCATGGGCTGGGGGG + Intergenic
976193380 4:82510352-82510374 TAATATTTCCAAGGGTTGGAAGG + Intronic
976492416 4:85686999-85687021 CAATATTGGCATGGGATGGAGGG + Intronic
976568715 4:86583872-86583894 GGATATTACAAGGGGGTGGAAGG - Intronic
977180335 4:93866196-93866218 CAACATTGCCTGGGGGAGGAGGG - Intergenic
979010987 4:115367835-115367857 CAATATTTCCATGGGATGATAGG - Intergenic
980270629 4:130579466-130579488 CAATTTTTCCAGGGACTGTAGGG - Intergenic
980714121 4:136610427-136610449 CAATATTTGCAGGCAGGGGATGG - Intergenic
980993137 4:139756229-139756251 CAACATTTTCATTGGGTGGAGGG - Intronic
981093290 4:140755577-140755599 CAATATTTTTAAGGGGGGGAGGG + Intronic
981207370 4:142059225-142059247 CAATGTCTCCTGTGGGTGGAGGG + Intronic
981420677 4:144546682-144546704 CTTTCTTTCCAGGGGGTGGGTGG + Intergenic
983624022 4:169786663-169786685 CATAATTTTCAGGGGGTGGAAGG - Intergenic
985771016 5:1810815-1810837 CAACATTACCAGGGGCTGGGGGG - Intronic
986006622 5:3673693-3673715 CAGTATTTGCAGGTGGTGGTAGG - Intergenic
987830853 5:23093077-23093099 CAATTTTTCCATGGGGTCAAAGG + Intergenic
988425240 5:31056190-31056212 TAAGATTTGCAGGGAGTGGAGGG - Intergenic
988455908 5:31387036-31387058 GAATATATCCTGGGTGTGGAAGG - Intergenic
989634098 5:43516159-43516181 CAACATTTCTAGTGGGTGGGTGG - Intergenic
992550511 5:77855381-77855403 AAATGTTTCCTGGGGGTTGAGGG - Intronic
994915149 5:105966545-105966567 CACTATATCCAGGTGATGGATGG + Intergenic
995143788 5:108763594-108763616 AAATGTTTCCAGGGAGGGGAAGG + Intronic
997150365 5:131487303-131487325 CAAAGCTTCCAGAGGGTGGAAGG + Intronic
997375632 5:133395181-133395203 CAAAGCTTCCACGGGGTGGAAGG - Intronic
997663621 5:135609032-135609054 TGATATTTCCTGGAGGTGGAAGG + Intergenic
997894460 5:137703779-137703801 AGATATTTCCAGGTGGAGGAGGG - Intronic
997947716 5:138217132-138217154 AAATATTGTCAGGGGCTGGAGGG - Intergenic
1002762478 6:212663-212685 GAAGATTTCCAGGGGCTGGGTGG + Intergenic
1003590857 6:7435517-7435539 CAGAATTTCCAGGGTGGGGATGG - Intergenic
1003801118 6:9668499-9668521 CAAAACTTCCACAGGGTGGAAGG - Intronic
1004025419 6:11813589-11813611 CAATATTTCCTGAGGGGGAACGG - Intergenic
1005216440 6:23533678-23533700 AAATATGTTCAGGGGCTGGATGG + Intergenic
1005384898 6:25276316-25276338 CAATGGTTACTGGGGGTGGAAGG + Intergenic
1005468788 6:26141568-26141590 CAATGTTCCCAGGTGCTGGAAGG + Intergenic
1005825457 6:29629009-29629031 CAGAATTTCAGGGGGGTGGAGGG + Intronic
1007692965 6:43714758-43714780 CAACACATCCATGGGGTGGAGGG - Intergenic
1008545400 6:52578831-52578853 AAAAATTAGCAGGGGGTGGAGGG - Intergenic
1010005508 6:70991473-70991495 CACCATGTCCAGGGTGTGGAGGG - Intergenic
1016466447 6:144330142-144330164 CCATAGTTCAAGGTGGTGGAGGG + Intronic
1020458677 7:8403368-8403390 CAAGAGTTCCAGGGGTTGGATGG + Intergenic
1021608478 7:22433284-22433306 CATTATGTGGAGGGGGTGGAAGG - Intronic
1021608512 7:22433463-22433485 CATTATGTGGAGGGGGTGGAAGG - Intronic
1022320413 7:29282941-29282963 CAATATCAGCAGGTGGTGGATGG + Intronic
1022539807 7:31125133-31125155 CAATTTTTCCAGGGACTGGGTGG + Intergenic
1022750583 7:33219825-33219847 CAAAATTTCCACAGTGTGGAAGG - Intronic
1022914555 7:34934609-34934631 CAATTTTTCCATGGGCTGGAGGG + Intronic
1027479273 7:78674326-78674348 CAATATTTCTTTGAGGTGGAAGG + Intronic
1030116496 7:106065691-106065713 CAATACCTCCAGGGGATGGGGGG + Intergenic
1032247186 7:130222957-130222979 CAATTTTTCCATGGATTGGAGGG - Intergenic
1032722881 7:134565130-134565152 CAAAGTTTCCACGGTGTGGAAGG - Intronic
1033544838 7:142390496-142390518 CAGTATTTCCATGGCCTGGAAGG + Intergenic
1035773643 8:2170464-2170486 CGATGTTTCCAGGGAGTGGAAGG + Intergenic
1037321422 8:17646881-17646903 TCATATTTCCAGGAGGTGCAGGG + Intronic
1039812555 8:41062614-41062636 CAATTTTTCCAGGGACTGGAGGG - Intergenic
1040048579 8:42989119-42989141 CAATATTAGAAGAGGGTGGAGGG + Intronic
1042336623 8:67636135-67636157 GATTATTTAAAGGGGGTGGAAGG + Intronic
1042821998 8:72939390-72939412 CAACCTTTTCAGGGGGTGGTTGG + Intergenic
1045924206 8:107567458-107567480 CATAATTTCCAGGGGGTGAGAGG + Intergenic
1048042336 8:130743507-130743529 CAATATTGGCAGGGAGGGGAGGG - Intergenic
1048094117 8:131272836-131272858 AAATGTTTCCAGGGGCTGGGAGG + Intergenic
1052753796 9:32520587-32520609 CAATAGTTCCTGGGCGTAGAGGG - Intronic
1052796065 9:32924568-32924590 CGACATTTCTAGTGGGTGGAGGG + Intergenic
1052921369 9:33972937-33972959 TAATACTTCCATGGGGTGGTAGG - Intronic
1054757785 9:68976623-68976645 CAATTTTTCCATGGATTGGACGG + Intronic
1055672555 9:78622190-78622212 AAATATTTTAAGGGAGTGGATGG + Intergenic
1056018009 9:82411802-82411824 CAATATTTCTAGGCTGTGGTTGG + Intergenic
1056378251 9:86035129-86035151 CAATATTGGCAGGGAGTCGAGGG - Intronic
1061038870 9:128128314-128128336 CGAGATTTCCAGGGAGAGGATGG + Exonic
1187504031 X:19864318-19864340 AAATCTTTGCAGGGGGTGGGGGG - Intronic
1190245689 X:48688874-48688896 CACCAGCTCCAGGGGGTGGAGGG - Exonic
1191189323 X:57649685-57649707 CAACATTTCTAGTGGGTGGGGGG + Intergenic
1192610810 X:72565071-72565093 CAAAATATCCAGGTGGTAGAAGG - Intronic
1192848638 X:74930571-74930593 CAAAATTTGGAGGGGTTGGATGG + Intergenic
1193888481 X:87013072-87013094 CAAAGTTTCCAGAGCGTGGAAGG + Intergenic
1194890364 X:99371623-99371645 CAAAGTTTCCACGGTGTGGAAGG + Intergenic
1195851505 X:109287237-109287259 CAATACTTCCAAAGAGTGGAAGG + Intergenic
1200326487 X:155245659-155245681 AAATATTTTCTGGGGTTGGAAGG - Intergenic