ID: 942702437

View in Genome Browser
Species Human (GRCh38)
Location 2:178728926-178728948
Sequence TGTCAAGCCAAGAATGAGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942702437_942702443 27 Left 942702437 2:178728926-178728948 CCTGACTCATTCTTGGCTTGACA 0: 1
1: 0
2: 2
3: 7
4: 137
Right 942702443 2:178728976-178728998 CACACTTCTGATTTGAAGTGTGG 0: 1
1: 0
2: 0
3: 14
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942702437 Original CRISPR TGTCAAGCCAAGAATGAGTC AGG (reversed) Exonic
900832580 1:4975805-4975827 TGTCAAGCTCAGAATGGGTGGGG - Intergenic
905873446 1:41417828-41417850 TGTCAAGCCCAGCATGTGTGAGG + Intergenic
907629491 1:56065971-56065993 TGTCAAACCAATAATGAATGAGG - Intergenic
911759450 1:101599365-101599387 TGTCTAGCAGAGAATGAGTAAGG + Intergenic
912083150 1:105963654-105963676 TGTCAAGACCAGAATCAGTGAGG - Intergenic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
917499327 1:175571761-175571783 TTTCAACCCAAGTATGAATCTGG - Intronic
918576733 1:186069719-186069741 TGTGTAGCCACGAATGAGGCTGG + Exonic
919450289 1:197764033-197764055 GGTCAAGCCTAGAATCAGTCAGG + Intronic
920497372 1:206464896-206464918 TGTCAAGGGCAGAATGACTCAGG - Intergenic
921075142 1:211694708-211694730 TGTCAAGCATACAATGATTCAGG + Intergenic
922479108 1:225926594-225926616 TGTTAAGAAAATAATGAGTCAGG - Intergenic
923337827 1:232985431-232985453 TGTCAAGGCAAAAATGGGTCAGG - Intronic
924144312 1:241058230-241058252 AGTAAAGGGAAGAATGAGTCAGG + Intronic
924662190 1:246031269-246031291 TGTCAAGCAAAGAAGGATTATGG + Intronic
1064494969 10:15899536-15899558 AATCCAGCCATGAATGAGTCAGG + Intergenic
1064646200 10:17462355-17462377 TTTCAAACCAAGAATGAGACAGG + Intergenic
1066463291 10:35631377-35631399 GGTCAAGCCAACAGTGGGTCAGG - Intergenic
1068200822 10:53782072-53782094 TGTCAAGACAATAATGGGTATGG + Intergenic
1068781450 10:60922873-60922895 GGTTAATCCAAGAAGGAGTCAGG + Intronic
1069177990 10:65318427-65318449 TGTGAATCCATGACTGAGTCAGG + Intergenic
1069619390 10:69827248-69827270 TGTCAAGACTACAAAGAGTCAGG + Intronic
1070572603 10:77651265-77651287 TTTAAAGCCAAGGATGAGGCAGG + Intergenic
1074466617 10:113688658-113688680 TGTTAACCCAAAAATCAGTCAGG + Intronic
1079843967 11:25440446-25440468 TGACATGCCAAGAATTATTCTGG - Intergenic
1085326496 11:75610609-75610631 TTTCAAGCCAAGGATGAGTGTGG + Intronic
1085874873 11:80394064-80394086 TCACAAGCCCAGAATGAGACAGG + Intergenic
1086481141 11:87241147-87241169 TGTCCAGCCAATAAATAGTCTGG - Intronic
1092961379 12:13599441-13599463 CATCAAGCCTAGAATGAGTCAGG - Intronic
1093397418 12:18700399-18700421 GCTCAATCCAAGTATGAGTCAGG + Intronic
1093832909 12:23786763-23786785 AGTCAAATCAAGAATGGGTCAGG - Intronic
1095168550 12:39005055-39005077 TGTCATGCCAAGATTGTTTCAGG - Intergenic
1097974578 12:65670977-65670999 TGTCACGATAAGAGTGAGTCAGG - Intergenic
1098641119 12:72839336-72839358 TGTTAAGCCAAGAGTGGGGCAGG - Intergenic
1100913501 12:99391512-99391534 TCTCATGCCAACAATGAGTGGGG - Intronic
1101135765 12:101741403-101741425 TATGAGGCCAAGAATGAGGCTGG - Intronic
1104361001 12:128133013-128133035 TTTCAAGCCAAGATAGAGACAGG - Intergenic
1108895275 13:55319275-55319297 TTTGAAGCCAAGAATGTCTCTGG + Intergenic
1111145993 13:84180972-84180994 TGCCAAGACAAGAATGAATGAGG + Intergenic
1112898262 13:104328607-104328629 TATCACACCAAGAATGAGTAGGG + Intergenic
1112901129 13:104358310-104358332 TGTGAAGCCAATCATGAGTAAGG + Intergenic
1113100597 13:106713432-106713454 TGTCTAACCAAGAAAGAGCCGGG + Intergenic
1115426080 14:33260951-33260973 TGTGAAGACAAAAATGAGTAGGG - Intronic
1118744008 14:68761263-68761285 AGTAAAGACAAGAATGAGTAGGG + Intergenic
1124713658 15:32036239-32036261 TATCAAGCCATGAAAGAGTATGG - Intronic
1128941490 15:71791228-71791250 AGTCAAGTCAAGACTGATTCAGG + Intergenic
1143301719 17:5915509-5915531 TCTCAGCCCCAGAATGAGTCAGG - Intronic
1143335278 17:6167480-6167502 TGTGAAGCCAAGCATGAGCTGGG - Intergenic
1149071616 17:52550438-52550460 TATAAAGTCAAGAAGGAGTCTGG + Intergenic
1150436728 17:65159814-65159836 TGTCACTCCAAGAATGAGCAAGG - Intronic
1150468726 17:65417559-65417581 TGGCAATCCAAGATTGCGTCTGG - Intergenic
1151166892 17:72211561-72211583 TGTGAACCCAAGAATGAAGCTGG - Intergenic
1151500133 17:74483048-74483070 TGTCATGCAAGGAAGGAGTCAGG - Intronic
1151775328 17:76197364-76197386 TGTAAAGCCAACTATGAGCCTGG + Intronic
1153061802 18:1002871-1002893 TTTCAAAACAAGAATGAATCAGG + Intergenic
1153692678 18:7609136-7609158 TTTCAAGCTAAAAATAAGTCTGG + Intronic
1156320173 18:36013128-36013150 GGTCAAGTCAAGAAGGAATCAGG - Intronic
1158839870 18:61373726-61373748 TGCCAAGGCAAGAAGGAGGCAGG - Intronic
1166041531 19:40205757-40205779 TGGCTAGCAAAGCATGAGTCGGG + Intronic
925465246 2:4102155-4102177 TCTCAAGCCAGGAATAAGGCTGG - Intergenic
929860906 2:45676601-45676623 TGTCCAGTCAAGAATGAAACAGG - Intronic
930900830 2:56506053-56506075 TGTCAAGCCAAGAAAGAACAGGG - Intergenic
931461196 2:62451634-62451656 TGTCAAGAGAAGATTGAGTTTGG + Intergenic
934605441 2:95691753-95691775 TGTCAAGTCACGAATGGGGCCGG + Intergenic
935442148 2:103111925-103111947 TCTCAAGTCAAGATTGTGTCAGG - Intergenic
935868038 2:107413127-107413149 TTTCCAAACAAGAATGAGTCAGG - Intergenic
936170014 2:110162570-110162592 GGGAAAGCCAAGAATGAGTAAGG + Intronic
936538903 2:113334298-113334320 TGTCAAGTCACGAATGGGGCCGG + Intergenic
936675511 2:114709379-114709401 TGACAAGCCAAAAATGAGTCAGG - Intronic
940312402 2:152292372-152292394 TGTCAAGTCAAAAATGATTTAGG - Intergenic
941060910 2:160845628-160845650 TGTTAACCCAAGAATCATTCAGG - Intergenic
942008682 2:171736573-171736595 TGGCAAGGCTAGAATGAATCAGG - Intronic
942488164 2:176461300-176461322 AGTCAACCAAAGAATGATTCTGG - Intergenic
942702437 2:178728926-178728948 TGTCAAGCCAAGAATGAGTCAGG - Exonic
942702674 2:178731340-178731362 TGTCAGGCCAAAAATGATGCAGG - Exonic
942705254 2:178764562-178764584 TGTGAAGCCAAGAATGACTATGG - Exonic
943868544 2:192961370-192961392 TGTCAAGCTAAAATTGAGTGGGG - Intergenic
1168881481 20:1209819-1209841 TGTGAAACCTAGAGTGAGTCAGG + Intergenic
1173853087 20:46231217-46231239 TGTTTAGCCAAGAATCAGTTGGG - Intronic
1177051545 21:16241167-16241189 TGTCAAATGAAGGATGAGTCAGG + Intergenic
1180747408 22:18099808-18099830 GGTCAAGCGAAGACTGAGGCAGG - Exonic
1180844900 22:18975659-18975681 TGTCAGGCCAAGGCTGAGGCTGG + Intergenic
1181056563 22:20263050-20263072 TGTCAGGCCAAGGCTGAGGCTGG - Intronic
1185153244 22:49178470-49178492 TGTCAAGCCCAGAAAGAGTCCGG + Intergenic
949243793 3:1901632-1901654 TGTCAAGCCAGAGATGAGTTAGG - Intergenic
950590582 3:13933440-13933462 TGTCCAGCCAAGCCTCAGTCAGG - Intergenic
951651559 3:24956575-24956597 TTTCAAGCCACAAATGTGTCTGG - Intergenic
952542490 3:34381041-34381063 TGTCAAGGCAGGAATGCATCAGG - Intergenic
959489377 3:106969712-106969734 TGTCAATCCAAGCTGGAGTCAGG - Intergenic
961043341 3:123692770-123692792 TGTGTAGCCAAGAATGACGCTGG - Exonic
961653352 3:128428459-128428481 TGCCAAGCCCAGAATGGCTCTGG - Intergenic
966437165 3:179901069-179901091 TGCCAAGCCAATTATCAGTCAGG - Intronic
967723271 3:192837625-192837647 TGACAATCCCTGAATGAGTCTGG + Intronic
968545904 4:1198237-1198259 TGTAAAGTCCAGAATGACTCTGG + Intronic
973719160 4:53705978-53706000 TTTCAAGCAAGGAATGAGGCAGG - Intronic
976439862 4:85060867-85060889 TGTCAAGTCAAGAAGGTGTAAGG + Intergenic
977286073 4:95108602-95108624 GATCAAGCCAAGAATGACTCTGG - Intronic
977379424 4:96252618-96252640 TTTCTAGCAAGGAATGAGTCAGG + Intergenic
977601235 4:98935876-98935898 TGTCAAGTCAAACCTGAGTCCGG - Intergenic
983690424 4:170463151-170463173 TGTAATGCCAAGATTGAATCAGG - Intergenic
984020468 4:174478765-174478787 TGTTAAGCCAAAAATCATTCAGG - Intergenic
987089914 5:14501567-14501589 TTTCCAGCCATGAGTGAGTCAGG + Intronic
987726242 5:21703554-21703576 AGAAAAGCCAAGAATGATTCTGG - Intergenic
988874748 5:35431618-35431640 AGTCAAGTCAAAAAGGAGTCTGG - Intergenic
991543403 5:67754541-67754563 TGTTAACCCAAGAATCATTCAGG - Intergenic
995527357 5:113060778-113060800 TGTCATGTCAAGGATGTGTCGGG + Intronic
996761151 5:126987255-126987277 TGTCAAGACAAGAATGACAGTGG - Intronic
998694277 5:144621086-144621108 TGTAAAGGCACGAATGAATCAGG + Intergenic
1000833812 5:166132407-166132429 TGTCAGTGCAAGAATGAGTAGGG + Intergenic
1005165347 6:22913533-22913555 TGGCAAAACAAGGATGAGTCCGG - Intergenic
1007205707 6:40148846-40148868 TTTGAAGCCAAGAGGGAGTCAGG + Intergenic
1008719764 6:54334616-54334638 AGTCAAGCCAAGATTGAGAGAGG + Intronic
1013973452 6:116047898-116047920 GGCAAAGCCAAGAATGAGTGTGG + Intronic
1014456853 6:121645401-121645423 TGTTATGCAAAGAATGAGACAGG + Intergenic
1015957160 6:138610739-138610761 AGAGAAGCCAAGAATGAGACAGG + Intronic
1015967976 6:138714019-138714041 TGGCAAGCGAAGACTGACTCTGG + Intergenic
1016289427 6:142511949-142511971 TGTCAACTGAACAATGAGTCAGG + Intergenic
1020216535 7:6195663-6195685 TGTCAAGCAATGAATGAGGAAGG + Intronic
1022263329 7:28728601-28728623 AGTCAAGACAAGAATGTGTTTGG - Intronic
1026307874 7:69158000-69158022 TTTCACGTCAAGAAGGAGTCCGG - Intergenic
1026441001 7:70444080-70444102 TGTAAAGCCAAGGAGGAGGCTGG + Intronic
1028315179 7:89392819-89392841 TATCAGGCCAAGAAGGAGCCAGG + Intergenic
1034861249 7:154596752-154596774 TGTCAAGCTAAGATTCAGACTGG - Intronic
1035214322 7:157353726-157353748 TGTCAAGGCTACAGTGAGTCAGG - Intronic
1035259924 7:157654485-157654507 ACTCAGGCCAAGTATGAGTCCGG - Intronic
1036501017 8:9313895-9313917 GGTCAACCCAAGATTGAGCCAGG + Intergenic
1045449474 8:102307427-102307449 AGCTAAGCTAAGAATGAGTCTGG + Intronic
1046424781 8:114032320-114032342 TGCCAACCTAAGAATGACTCAGG - Intergenic
1047355645 8:124119235-124119257 AGTCAAGCGATGAATGAGTTAGG + Intronic
1047812516 8:128425885-128425907 TGTCAAGCCACTAAGGAGACAGG + Intergenic
1048428064 8:134341019-134341041 TGTCAATATAAGCATGAGTCTGG - Intergenic
1050094406 9:2048228-2048250 TGTCAACCCAAAAGGGAGTCCGG + Intronic
1052479112 9:28998987-28999009 AGTCAAGCAAACCATGAGTCAGG + Intergenic
1057047312 9:91896281-91896303 TGTTCAGCCAAGACAGAGTCAGG - Intronic
1060261309 9:122076352-122076374 TGGCAAGGCAAGAATCAGACTGG + Intronic
1060903719 9:127285563-127285585 GGTCAAGGCAAAAATGAGTATGG - Intronic
1061732330 9:132625378-132625400 GGTCCAGGCCAGAATGAGTCTGG - Intronic
1188517237 X:31000579-31000601 TGTCAAACCCAGAAAGACTCAGG - Intergenic
1188522831 X:31057797-31057819 AGTCAAGCCGAGAATTAGTGTGG - Intergenic
1188670125 X:32871922-32871944 GGTTAAGGCATGAATGAGTCAGG + Intronic
1189291752 X:39890956-39890978 TGTCAACCCACAAATGTGTCTGG + Intergenic
1190058607 X:47196625-47196647 TCTCAAGGCAAGCAGGAGTCTGG - Intronic
1194632985 X:96309625-96309647 TATCAAGCCAAGAAATGGTCTGG + Intergenic
1196249340 X:113440916-113440938 TGTGAAGCCATGAATGACCCAGG + Intergenic
1196798777 X:119523767-119523789 TGTCAAGGCAGGAATGTGCCTGG + Intergenic
1199750686 X:150814769-150814791 TGCCAAGCCCAGACTGACTCTGG + Intronic
1201516976 Y:14828773-14828795 TGTAAATCCCAGACTGAGTCAGG - Intronic