ID: 942707604

View in Genome Browser
Species Human (GRCh38)
Location 2:178794229-178794251
Sequence CTTTCTGAGCAAAAGGTGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 227}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942707604_942707608 -8 Left 942707604 2:178794229-178794251 CCGACCACCTTTTGCTCAGAAAG 0: 1
1: 0
2: 1
3: 19
4: 227
Right 942707608 2:178794244-178794266 TCAGAAAGTTCTAAAAGTCTGGG 0: 1
1: 0
2: 1
3: 25
4: 258
942707604_942707609 1 Left 942707604 2:178794229-178794251 CCGACCACCTTTTGCTCAGAAAG 0: 1
1: 0
2: 1
3: 19
4: 227
Right 942707609 2:178794253-178794275 TCTAAAAGTCTGGGCCCTGCTGG 0: 1
1: 0
2: 0
3: 20
4: 156
942707604_942707607 -9 Left 942707604 2:178794229-178794251 CCGACCACCTTTTGCTCAGAAAG 0: 1
1: 0
2: 1
3: 19
4: 227
Right 942707607 2:178794243-178794265 CTCAGAAAGTTCTAAAAGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 197
942707604_942707611 9 Left 942707604 2:178794229-178794251 CCGACCACCTTTTGCTCAGAAAG 0: 1
1: 0
2: 1
3: 19
4: 227
Right 942707611 2:178794261-178794283 TCTGGGCCCTGCTGGGCTCAAGG 0: 1
1: 1
2: 2
3: 46
4: 495
942707604_942707610 2 Left 942707604 2:178794229-178794251 CCGACCACCTTTTGCTCAGAAAG 0: 1
1: 0
2: 1
3: 19
4: 227
Right 942707610 2:178794254-178794276 CTAAAAGTCTGGGCCCTGCTGGG 0: 1
1: 0
2: 3
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942707604 Original CRISPR CTTTCTGAGCAAAAGGTGGT CGG (reversed) Intronic
900457924 1:2786325-2786347 CTGTCTGAGCACTAGGAGGTTGG + Intronic
900947071 1:5837058-5837080 CTTTCTGAACTAGAGGTGGGCGG + Intergenic
901846672 1:11987384-11987406 CTTTCGGAGGACAAGGTGGGTGG + Intronic
911613124 1:99978673-99978695 TTTTGTGAGCAAAAAGTGGATGG + Intronic
912713369 1:111965191-111965213 CTTTCTGAGTAAAAGGGGTGTGG + Intronic
914333166 1:146691183-146691205 CTTTCTGAGCTGAAGTTGGGTGG - Intergenic
915119431 1:153619459-153619481 CTTTCTGAGAAAGAGGAGGGTGG - Intronic
921884178 1:220287861-220287883 CCTTCTGAGGAAGAGGTAGTGGG - Intergenic
922275212 1:224071227-224071249 CTTTCCGAGACAAAGGTGGGTGG - Intergenic
922436346 1:225611218-225611240 CTTTGGGAGCCAAAGGTGGAAGG + Intronic
922881859 1:228987040-228987062 TTTTCTTAGCAAAAGGTAGTAGG - Intergenic
924413624 1:243833814-243833836 CTTTGGGAGGAAAAGGTGGGAGG + Intronic
1063095729 10:2907362-2907384 CTCTCAGAGCAAAACGTGGAAGG - Intergenic
1063247374 10:4235998-4236020 CTTTCTGGTCAAAAAATGGTTGG - Intergenic
1065439369 10:25734283-25734305 ATTTCTGAATAAAAGGTTGTTGG - Intergenic
1068497823 10:57807549-57807571 CTTTGGGAGGAAAAGGTGGGAGG + Intergenic
1070019121 10:72566287-72566309 CTTTGGGAGCCCAAGGTGGTTGG - Intronic
1070695622 10:78561194-78561216 CTCTGTGAGGAAAAGGTGGGGGG + Intergenic
1070951755 10:80436781-80436803 CTTTCTGTGTAAAAACTGGTTGG + Exonic
1072413723 10:95229958-95229980 CTTCCTGAGCAAAATATAGTTGG - Intergenic
1073404155 10:103282238-103282260 TTTTCTGAATAAGAGGTGGTTGG - Intronic
1076135682 10:128044436-128044458 CTTCCTGAGCAGAGGGTGCTGGG + Intronic
1076284299 10:129277952-129277974 CTTTCTGCCCAGCAGGTGGTGGG + Intergenic
1078378000 11:10812355-10812377 ATCTCTGAGCAAAAGGCTGTTGG - Intronic
1079470171 11:20770491-20770513 CTTCCTGAGCACAAGGTTGAAGG + Intronic
1080324523 11:31054744-31054766 CTTTTTCAGCAAATGGTGCTGGG + Intronic
1085014462 11:73163771-73163793 CAATCTGAGCAAAAGGTTGCTGG + Intergenic
1085807500 11:79649784-79649806 CTTTGTGAGTAGAATGTGGTCGG - Intergenic
1086159364 11:83704148-83704170 CTTTCTAAGTAAAAGCTGGCAGG + Intronic
1086978129 11:93161081-93161103 CTTTGGGAGGAAAAGGTGGGAGG - Intronic
1088331872 11:108662990-108663012 CTTTCTGAGGCCAAGGTGGGAGG - Intergenic
1089042966 11:115471330-115471352 CTGTTTGAGCAATAGGTGCTTGG - Intronic
1089177946 11:116561754-116561776 CTTTCTTTGCAAAGGCTGGTTGG - Intergenic
1090723903 11:129504450-129504472 CTTTGTAACCAAAAGGTGGTAGG - Intergenic
1091635977 12:2196988-2197010 TTTTCTGAGCAAAAGGCAGGTGG - Intronic
1092300271 12:7241764-7241786 CTTTCTGAGCAAAATTTAGTTGG - Intergenic
1092387047 12:8043846-8043868 CTTTCAGAGGCAAAGGTGGAAGG + Intronic
1092823888 12:12378996-12379018 CTTTGTGAGGCAAAGGTGGGAGG - Intronic
1092882905 12:12901563-12901585 CTTACTGAGCATCAGGTGCTAGG + Intronic
1092982128 12:13807180-13807202 CTTTATGAAAAAAAGGTGGTTGG + Intronic
1093210571 12:16303323-16303345 CTTCATGGGCAAATGGTGGTAGG + Intergenic
1095907461 12:47392438-47392460 CTTTGGGAGGAAGAGGTGGTCGG + Intergenic
1096131827 12:49165425-49165447 CTTTGTGAGGTCAAGGTGGTAGG - Intergenic
1097065549 12:56317931-56317953 CTTTGTGAGCCCAAGGTGGGTGG + Intronic
1097829897 12:64213149-64213171 CTTTCTGAGCATAAGATGGTTGG - Intronic
1100898291 12:99210377-99210399 CCTGCTGAGCAAAAAATGGTAGG - Intronic
1103708245 12:122891977-122891999 CTTTCTGAGGAAATGCTGATTGG - Intronic
1104256711 12:127146041-127146063 CGTTCTCAGGAAAGGGTGGTGGG - Intergenic
1104524890 12:129511575-129511597 CTTTCACAGCCAAAGGTGCTGGG + Intronic
1105561660 13:21497996-21498018 CTTTCTGAGGCTAAGGTGGGAGG - Intronic
1109698081 13:65987693-65987715 CTTTGGGAGGCAAAGGTGGTTGG - Intergenic
1110175478 13:72550734-72550756 CTTTCTCATAAAAAGGTGGAGGG - Intergenic
1112025973 13:95411463-95411485 CTGTCTGAGCATAAGGTGGGGGG + Intergenic
1112920905 13:104611774-104611796 CCTTCTGAGCACAAGGCTGTAGG - Intergenic
1113223757 13:108135882-108135904 CTTTCTGAGAACAAGGTCATAGG - Intergenic
1116013956 14:39384323-39384345 TTTTCTGAGCAGTAGGTCGTGGG - Intronic
1116807332 14:49506765-49506787 CTTTCTGAGTTAATTGTGGTTGG - Intergenic
1119813387 14:77543294-77543316 CTTTCTGAGGCCAAGGTGGGCGG - Intronic
1122677354 14:103426766-103426788 CTTTCTGAACAAAGGCTGCTAGG + Intronic
1123193522 14:106593986-106594008 TTTTCTGAGAAAATGGTGTTGGG - Intergenic
1123202155 14:106676326-106676348 TTTTCTGAGAAAATGGTGTTGGG - Intergenic
1126339105 15:47620119-47620141 CTGTCTGGGCAAAAGATGGGAGG - Intronic
1127102156 15:55577380-55577402 GTTCCTGAGCCCAAGGTGGTGGG - Intronic
1128696429 15:69767142-69767164 CTTTCCCAGCAAAGGGTGCTGGG - Intergenic
1129754742 15:78091121-78091143 CTTTGGGAGCACAAGGTGGGAGG - Intronic
1130068862 15:80629628-80629650 CTTTCAGGGCAAAAGGTGAGGGG - Intergenic
1131498265 15:92934249-92934271 CTTTATTGGGAAAAGGTGGTTGG - Intronic
1131509914 15:93044269-93044291 CTTTCTAAGCACAGGGTGGAAGG + Intronic
1131551566 15:93361827-93361849 ATGGTTGAGCAAAAGGTGGTGGG - Intergenic
1134430563 16:14200796-14200818 CCTTCAGAGTAAAAAGTGGTTGG + Intronic
1134650539 16:15905008-15905030 CTTTCGGAGGTAAAGGTGGGTGG + Intergenic
1135000314 16:18771613-18771635 CTTTGTGAGGCCAAGGTGGTTGG - Intergenic
1135030386 16:19033436-19033458 CTTTCTGAGTACAAGGTGGGTGG + Intronic
1135567343 16:23521641-23521663 CTTTGTGAGGCAAAGGTGGTAGG - Intronic
1137592983 16:49705086-49705108 CTTTCTGGGAAAAAGGTGGGAGG + Intronic
1138117360 16:54371102-54371124 CTTTCTGAGCCACATGGGGTGGG - Intergenic
1140000455 16:71020071-71020093 CTTTCTGAGCTGAAGTTGGGTGG + Intronic
1143123742 17:4627252-4627274 CTATTTGAGCAAAGGGTGATAGG - Intergenic
1143889578 17:10092282-10092304 CTCTCAGAGCAAAGGGTGGCAGG - Intronic
1144130741 17:12244829-12244851 CCTTCTGACAAATAGGTGGTGGG - Intergenic
1144491806 17:15719273-15719295 TCTTCTGAGAAACAGGTGGTGGG - Exonic
1144908674 17:18659931-18659953 TCTTCTGAGAAACAGGTGGTGGG + Exonic
1146074761 17:29717861-29717883 CTATCTGAAAAAAAGGTAGTGGG + Intronic
1150077155 17:62202298-62202320 CTTTCTGAGCCTGAGGTGGGAGG + Intergenic
1151114346 17:71717074-71717096 CTTTATGAGCAAGCTGTGGTGGG - Intergenic
1152013171 17:77733252-77733274 CTTTCTGGGGAAAAGATGGTGGG - Intergenic
1152380946 17:79941985-79942007 CTTTCTGAGAACGAGCTGGTGGG + Intronic
1155069523 18:22301949-22301971 GTTTCTAAGCAGAAAGTGGTAGG + Intergenic
1157188044 18:45557483-45557505 CTTCCTAAGGAAAAGGTGTTTGG + Intronic
1157525826 18:48380936-48380958 TTTTCTCTCCAAAAGGTGGTAGG - Intronic
1157609273 18:48946123-48946145 CCATCTTAGGAAAAGGTGGTGGG - Intronic
1157955561 18:52093773-52093795 GGTTCTGAGCCAAAGGTGCTGGG + Intergenic
1158064481 18:53389165-53389187 CTTTCTCAGCAAAAGTTTGGAGG + Intronic
1158474419 18:57767304-57767326 CTTTCTGAGGAAATGGAGCTTGG - Intronic
1160356858 18:78235398-78235420 ATTTATCAGCAAAAGCTGGTTGG - Intergenic
1165779541 19:38424361-38424383 CTTTCAGAGGCAAAGGTGGGAGG - Intronic
1165781767 19:38438859-38438881 CTTTCGGAGGACAAGGTGGGAGG - Intronic
1166567388 19:43773626-43773648 CTTTCAGAGAAAAACGAGGTTGG - Intronic
1167491841 19:49797222-49797244 CCTTTTCAGCAAATGGTGGTGGG + Intronic
926039042 2:9658026-9658048 CTCTGTGAGCAGAAGGTGGAGGG - Intergenic
930791145 2:55330252-55330274 CTTTCAGAGGACAAGGTGGGTGG + Intronic
932067693 2:68583889-68583911 GTTTCAGTGGAAAAGGTGGTGGG - Intronic
936120058 2:109733607-109733629 CTTTGTGAGGCCAAGGTGGTTGG + Intergenic
937738806 2:125323734-125323756 CTTGCAGACCAGAAGGTGGTTGG + Intergenic
939654393 2:144805393-144805415 CATACTGGGCAAAAGGTGGCAGG - Intergenic
942707604 2:178794229-178794251 CTTTCTGAGCAAAAGGTGGTCGG - Intronic
942924994 2:181420900-181420922 CTTTCTGAGGAACAGAGGGTTGG - Intergenic
943407066 2:187502470-187502492 CTTTTTTCTCAAAAGGTGGTGGG - Intronic
943908514 2:193531911-193531933 CCTTCTGATCTAAAGGTGATGGG + Intergenic
944338656 2:198568430-198568452 CTTTCAGAGCCCCAGGTGGTCGG - Intronic
945599685 2:211845113-211845135 CTTTATGAGTAACAGGTGGAAGG + Intronic
946287099 2:218711993-218712015 CTTTCTGAGCACAAAGTGGGTGG - Intronic
1170080006 20:12464269-12464291 CTTTCTGAGATAAGGGTGCTGGG + Intergenic
1170257381 20:14360095-14360117 CTTGCTGGGCACAGGGTGGTGGG + Intronic
1173276501 20:41588853-41588875 ATTTCTAATCAAAAGGTGATTGG + Intronic
1173439089 20:43059369-43059391 CTTTCTAAGCAAAATGTTGAAGG - Intronic
1173656084 20:44701188-44701210 TTTTGGGAGCAACAGGTGGTGGG - Intergenic
1177319497 21:19501703-19501725 CTTTCTAAGAAAAGGTTGGTAGG - Intergenic
1177528357 21:22328120-22328142 CTTTGGGAGGCAAAGGTGGTAGG - Intergenic
1178572977 21:33758124-33758146 CTTTGGGAGGACAAGGTGGTAGG - Intronic
1178979991 21:37255675-37255697 CAGTCTCAGCAAAAGCTGGTGGG - Intronic
1179371486 21:40810025-40810047 CTTACTGGGCAGCAGGTGGTGGG - Intronic
1181713986 22:24710972-24710994 CTTTTTCAGCAAACGGTGCTGGG + Intergenic
1181940725 22:26474054-26474076 GTTTCTGAAGAAAAGCTGGTGGG - Intronic
1183096102 22:35553212-35553234 CTGTGTGTGCAGAAGGTGGTGGG - Exonic
1183568475 22:38633781-38633803 CTTTGGGAGGCAAAGGTGGTTGG - Intronic
1185348094 22:50319430-50319452 CAGTCTGGGCAAGAGGTGGTTGG - Intronic
949263203 3:2126429-2126451 CTTTCTGAGCAATAAGAAGTAGG + Intronic
949727293 3:7063950-7063972 CGTGTAGAGCAAAAGGTGGTGGG + Intronic
951673099 3:25206706-25206728 CTTTCTGGAAAAAATGTGGTAGG + Intronic
951813408 3:26726728-26726750 CTCTCTGAGGAAAAGTTGGCAGG - Intergenic
953163077 3:40440156-40440178 GTTTCTGAGCTAGATGTGGTGGG - Intergenic
953228805 3:41045040-41045062 CTATCTGAGCAAAAGGTAGAAGG + Intergenic
953366427 3:42349492-42349514 CTTTGGGAGCCCAAGGTGGTAGG - Intergenic
955607681 3:60723175-60723197 CTATATGTGCAAAAGGTGTTAGG - Intronic
957638318 3:82815576-82815598 GTTCCTGAGCAGAAGGGGGTGGG - Intergenic
958465626 3:94454045-94454067 TTTGCTGAGCCACAGGTGGTGGG + Intergenic
959578108 3:107956988-107957010 TTTTCTGAGCAAAAGGGTGGTGG - Intergenic
959686547 3:109153503-109153525 CTTTCAGAGGCAAAGGTGGGTGG + Intergenic
959887675 3:111521156-111521178 CTTTCTGAGCAAAGGGTGTCAGG + Intronic
960990520 3:123307799-123307821 CTTTCTTAATAAAAGGTGGTTGG + Intronic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
965555172 3:170011174-170011196 CTTTGTGAGGCAAAGGTGGGAGG - Intergenic
965730262 3:171763920-171763942 ATGTCTGAGAAAGAGGTGGTAGG - Intronic
966158096 3:176940024-176940046 CTTTGGGAGCCAAAGGTGGGCGG + Intergenic
967098165 3:186194144-186194166 CTTCCTGAGCCACGGGTGGTTGG + Intronic
967326079 3:188241162-188241184 CTCTAGGAGCAGAAGGTGGTGGG + Intronic
967868500 3:194210103-194210125 CTCTTTGGGCAAAGGGTGGTGGG - Intergenic
968173840 3:196531590-196531612 CTTTGGGAGGAAAAGGTGGGTGG - Intergenic
970507135 4:16743044-16743066 CTTTGGGAGCACAAGGTGGGTGG + Intronic
971090540 4:23338502-23338524 GTTTCTGAAGAAAAGTTGGTTGG - Intergenic
971352443 4:25865369-25865391 CATCCTGAGCTAGAGGTGGTGGG + Intronic
972975638 4:44631930-44631952 TTTTCTGAGGAAAAGGTATTTGG - Intronic
974874789 4:67690194-67690216 TATTCAGAGGAAAAGGTGGTTGG + Intronic
974973027 4:68854186-68854208 ATTCCTGGGCAAAAGGGGGTGGG - Intergenic
975315354 4:72945939-72945961 CTCACTGAGCTACAGGTGGTGGG - Intergenic
976689084 4:87849175-87849197 CTTTTTGAGCACAAGGTGGCAGG - Intergenic
977834034 4:101627941-101627963 CTTTTTGAACAAATGGTGCTGGG - Intronic
981557653 4:146012803-146012825 CTTTCTGAGGTCAAGGTGGGTGG - Intergenic
981986189 4:150860326-150860348 CTTTGACAGCAAAAAGTGGTAGG + Intronic
982300503 4:153873966-153873988 TTTTCTGAGCAGCAGGTTGTGGG - Intergenic
982376144 4:154692918-154692940 CACTCTGAGGAAAAGGTGGGAGG + Intronic
982867548 4:160535958-160535980 CTTGCTGTGCAAAAAATGGTTGG - Intergenic
983069723 4:163254153-163254175 GTTTCTGAGCAGAAAGGGGTGGG - Intergenic
987350750 5:17019797-17019819 CTTTCTGAATAAATGATGGTGGG - Intergenic
988105355 5:26740132-26740154 ATATCTGAGCAAAAAATGGTAGG + Intergenic
989448457 5:41558950-41558972 CATTCTGACCATATGGTGGTGGG - Intergenic
990661703 5:58022692-58022714 CTTTCTGAGGGAAAGGAGATAGG - Intergenic
991968867 5:72119124-72119146 CTTTCTGTACACAAGGTGGGTGG + Intronic
992213747 5:74505844-74505866 CTTTATGCTCAAAAAGTGGTTGG + Intergenic
992590168 5:78286433-78286455 CTTACTGGGCAGAAGGTGGAAGG - Intronic
993387258 5:87274789-87274811 TTTTCTGAGCAAGAGGTTATTGG + Intronic
995374032 5:111453469-111453491 CTTTCTGAGAATAAGTTGGTGGG + Intronic
995511890 5:112918772-112918794 CTGTGTGAGCAAAGAGTGGTGGG - Intronic
995717793 5:115097309-115097331 CTTTCTGAGGCCAAGGTGGGTGG - Intergenic
997791993 5:136769813-136769835 CTTTCAGAGCACAGTGTGGTGGG + Intergenic
999087263 5:148903926-148903948 TTTTGTGAGCCAAAGGTGGATGG - Intergenic
999303943 5:150507951-150507973 CTTTCTGAGGTTAAGGAGGTAGG + Intronic
999920143 5:156308982-156309004 CTTTCTCATCAAAAGTTAGTGGG - Intronic
1001018128 5:168160073-168160095 CATGCTGAGCAAATGTTGGTAGG + Intronic
1001054234 5:168436084-168436106 CTTTCGGAGGAAAAGGTGGGTGG - Intronic
1001305242 5:170567651-170567673 CTTTCTGATCAGAAGTTGGATGG + Intronic
1005629139 6:27690989-27691011 CTTTCAGAGGTAATGGTGGTGGG + Intergenic
1006210441 6:32389091-32389113 CTTTCTGAGGACAAGGCGGGTGG - Intergenic
1006940273 6:37747516-37747538 CATTCTGAGCAAAAGGTCCAGGG - Intergenic
1007091513 6:39187632-39187654 CTTTCTGAGTAAGAGATGGGAGG - Intergenic
1007505743 6:42333866-42333888 CTTGATGACCAGAAGGTGGTCGG - Intronic
1008265806 6:49424760-49424782 CTTTCTGAGCAAAACCTGCGTGG - Intergenic
1009261755 6:61499470-61499492 CTTTCTGAGCAACAGCTTTTAGG - Intergenic
1009909576 6:69909190-69909212 CTTTCTAAGGAAAAGAGGGTAGG + Intronic
1010656598 6:78518594-78518616 CTTTCTCAGCAGAGGGTGATGGG - Intergenic
1011293326 6:85800323-85800345 TGTTCTGAGGAAAAGGTGATGGG + Intergenic
1012029947 6:94046296-94046318 CTTTCTGAAGAGAAGGTGGAAGG - Intergenic
1015584471 6:134761193-134761215 CTTTCTGAGGCCAAGGTGGGTGG + Intergenic
1015802778 6:137077518-137077540 CTTTGTGAGGAAAAGGTGGGAGG + Intergenic
1020678680 7:11209446-11209468 CTTGCTGAGACAAAGGAGGTAGG - Intergenic
1020695148 7:11404672-11404694 CTGGCTCAGCAAAAGGTTGTTGG + Intronic
1021930250 7:25573734-25573756 CTTTCTGACTAAAATGTGATTGG - Intergenic
1022027973 7:26466462-26466484 ATTTCTGAGCAAAGGGTAGGAGG + Intergenic
1023651365 7:42372715-42372737 CTGTCTGAGCAAAGAGTGGAGGG + Intergenic
1025743084 7:64216847-64216869 CTTTGGGAGGCAAAGGTGGTAGG - Intronic
1026023426 7:66727835-66727857 ATTTGTGAGCCAGAGGTGGTGGG + Intronic
1027641656 7:80741288-80741310 ATTCCTGTGCAAAAGGTGCTTGG + Intergenic
1027958832 7:84917723-84917745 CTTTCTGAGCCAAAGAAGTTAGG - Intergenic
1028297777 7:89156413-89156435 CCTTCTGAGAAAGAGGTGGTCGG - Intronic
1028835091 7:95365983-95366005 CCTTCTGAGGAAGTGGTGGTTGG + Intronic
1030026830 7:105332518-105332540 CTTTGTGAGGTCAAGGTGGTTGG + Intronic
1031475068 7:122211348-122211370 CTTCCTGAGGAAGAGATGGTAGG + Intergenic
1031965080 7:128021958-128021980 CTTTGTGAGCCCAAGGTGGGCGG + Intronic
1034025959 7:147704424-147704446 CCTTCTGAAGAAAGGGTGGTTGG + Intronic
1035092973 7:156329746-156329768 TTTTCTGAGCAGAGGGTGGAAGG - Intergenic
1038544629 8:28415958-28415980 CTTTCGGAGACAAAGGTGGGTGG + Intronic
1040909271 8:52501990-52502012 GACACTGAGCAAAAGGTGGTAGG + Intergenic
1042312366 8:67391752-67391774 CCTATTGATCAAAAGGTGGTAGG + Intergenic
1042767127 8:72334827-72334849 CTTTCTGAGGCCAAGGTGGGTGG - Intergenic
1043075334 8:75691830-75691852 CTTACTGAATAAATGGTGGTGGG - Intergenic
1043618741 8:82160845-82160867 CTTGCTGAGCAGCGGGTGGTGGG + Intergenic
1044994973 8:97830155-97830177 CTTTCTTAGCAAAAAATTGTTGG - Intronic
1046844646 8:118902281-118902303 CTTTCTGAGCCTAAGCTGGAAGG + Intergenic
1046844652 8:118902315-118902337 CTTTCTGAGCCTAAGCTGGGAGG + Intergenic
1049376358 8:142291202-142291224 CTTTCTGAGATGAGGGTGGTGGG - Intronic
1050419799 9:5451610-5451632 CTTTCTCAGTAAAAGTAGGTAGG + Intronic
1050487891 9:6154039-6154061 CTTTGGGAGCCCAAGGTGGTTGG - Intergenic
1051599334 9:18856870-18856892 TTTTCAGAGCAAAAGCTGGTTGG + Intronic
1052068052 9:24047217-24047239 CTTTCTCACAAAATGGTGGTTGG + Intergenic
1053391528 9:37739845-37739867 CTCTCTGAGCTAAAGGAGGCTGG - Intronic
1054711928 9:68519815-68519837 CTTTCAGAGGCCAAGGTGGTAGG + Intronic
1057078813 9:92156506-92156528 CTTTCGGAGCCCAAGGTGGAAGG + Intergenic
1057907872 9:98996236-98996258 CTTTCTAAGCTAAAGGGGCTGGG - Intronic
1058052286 9:100419042-100419064 CTTCCTGGGCAATAGGCGGTGGG - Intergenic
1058396881 9:104564404-104564426 CTTTCTTAAAAAAAGGGGGTTGG + Intergenic
1058546331 9:106063909-106063931 ATTTCTGAGCAAAATGTCGAAGG + Intergenic
1058582896 9:106478394-106478416 TTTTCTGGGCAAAAGGGGCTGGG + Intergenic
1059399288 9:114058912-114058934 CTTTCTGGGCAGAAGCAGGTGGG - Intergenic
1059430029 9:114244505-114244527 CATTCTGGGCAAAAGATTGTCGG + Intronic
1059986844 9:119828529-119828551 CATTTTGTGAAAAAGGTGGTTGG - Intergenic
1060683865 9:125590404-125590426 CTTTGGGAGGAAAAGGTGGGTGG + Intronic
1061267336 9:129514424-129514446 CTTCCTGGGCAGAAGGGGGTGGG + Intergenic
1061361743 9:130147654-130147676 CTTTGTGAGCCCAAGGTGGGCGG + Intergenic
1186125776 X:6412265-6412287 CTTTCTGAGGAATATGTGTTTGG - Intergenic
1186790252 X:12990361-12990383 CTTTGGGAGGAAAAGGTGGGAGG + Intergenic
1191633698 X:63353022-63353044 TCTTCTGAGCAAAAAGTGCTTGG - Intergenic
1191865266 X:65698642-65698664 CTTCCTGTGCAAAAGAGGGTGGG + Intronic
1192194745 X:69020793-69020815 CTTTAAGAGCAAACGGTGGGAGG + Intergenic
1195583863 X:106539893-106539915 TTTTCTTAGGAAAAAGTGGTAGG - Intergenic
1197265175 X:124361766-124361788 ATTTCTGAGCAAAAAGTTGAAGG + Intronic
1197401507 X:125997374-125997396 CTTTCTGAGAAGAAAGTAGTTGG + Intergenic
1201539355 Y:15089566-15089588 TTTTTCGAGCAAAAGTTGGTAGG + Intergenic