ID: 942708050

View in Genome Browser
Species Human (GRCh38)
Location 2:178799507-178799529
Sequence TGCCCGCACGTGTCTGACCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942708046_942708050 -2 Left 942708046 2:178799486-178799508 CCTGACCGGAGATGGGGTCGGTG 0: 1
1: 0
2: 0
3: 4
4: 71
Right 942708050 2:178799507-178799529 TGCCCGCACGTGTCTGACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 37
942708047_942708050 -7 Left 942708047 2:178799491-178799513 CCGGAGATGGGGTCGGTGCCCGC 0: 1
1: 0
2: 2
3: 4
4: 61
Right 942708050 2:178799507-178799529 TGCCCGCACGTGTCTGACCGGGG 0: 1
1: 0
2: 0
3: 1
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942708050 Original CRISPR TGCCCGCACGTGTCTGACCG GGG Exonic