ID: 942718500

View in Genome Browser
Species Human (GRCh38)
Location 2:178922408-178922430
Sequence GTGTCAAGACTGAGAAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942718500_942718503 30 Left 942718500 2:178922408-178922430 CCAGCTCTTCTCAGTCTTGACAC No data
Right 942718503 2:178922461-178922483 ATATTATTTTGGAATTGCCTAGG No data
942718500_942718501 19 Left 942718500 2:178922408-178922430 CCAGCTCTTCTCAGTCTTGACAC No data
Right 942718501 2:178922450-178922472 AATGATTAACCATATTATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942718500 Original CRISPR GTGTCAAGACTGAGAAGAGC TGG (reversed) Intronic
No off target data available for this crispr