ID: 942737184 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:179127752-179127774 |
| Sequence | CTTGTTTATCAGTTATTGTT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942737181_942737184 | 12 | Left | 942737181 | 2:179127717-179127739 | CCTATATCCAATGGTGATGATAA | No data | ||
| Right | 942737184 | 2:179127752-179127774 | CTTGTTTATCAGTTATTGTTTGG | No data | ||||
| 942737180_942737184 | 15 | Left | 942737180 | 2:179127714-179127736 | CCTCCTATATCCAATGGTGATGA | No data | ||
| Right | 942737184 | 2:179127752-179127774 | CTTGTTTATCAGTTATTGTTTGG | No data | ||||
| 942737182_942737184 | 5 | Left | 942737182 | 2:179127724-179127746 | CCAATGGTGATGATAATATCTGT | No data | ||
| Right | 942737184 | 2:179127752-179127774 | CTTGTTTATCAGTTATTGTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942737184 | Original CRISPR | CTTGTTTATCAGTTATTGTT TGG | Intronic | ||
| No off target data available for this crispr | |||||