ID: 942737184

View in Genome Browser
Species Human (GRCh38)
Location 2:179127752-179127774
Sequence CTTGTTTATCAGTTATTGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942737181_942737184 12 Left 942737181 2:179127717-179127739 CCTATATCCAATGGTGATGATAA No data
Right 942737184 2:179127752-179127774 CTTGTTTATCAGTTATTGTTTGG No data
942737180_942737184 15 Left 942737180 2:179127714-179127736 CCTCCTATATCCAATGGTGATGA No data
Right 942737184 2:179127752-179127774 CTTGTTTATCAGTTATTGTTTGG No data
942737182_942737184 5 Left 942737182 2:179127724-179127746 CCAATGGTGATGATAATATCTGT No data
Right 942737184 2:179127752-179127774 CTTGTTTATCAGTTATTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942737184 Original CRISPR CTTGTTTATCAGTTATTGTT TGG Intronic
No off target data available for this crispr