ID: 942737912 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:179137627-179137649 |
Sequence | CTGTAACAGCAGCAGCAGTA TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
942737911_942737912 | 5 | Left | 942737911 | 2:179137599-179137621 | CCAGAAGCATGTGAAATCTAATT | No data | ||
Right | 942737912 | 2:179137627-179137649 | CTGTAACAGCAGCAGCAGTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
942737912 | Original CRISPR | CTGTAACAGCAGCAGCAGTA TGG | Intronic | ||