ID: 942737912

View in Genome Browser
Species Human (GRCh38)
Location 2:179137627-179137649
Sequence CTGTAACAGCAGCAGCAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942737911_942737912 5 Left 942737911 2:179137599-179137621 CCAGAAGCATGTGAAATCTAATT No data
Right 942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942737912 Original CRISPR CTGTAACAGCAGCAGCAGTA TGG Intronic
No off target data available for this crispr