ID: 942738173

View in Genome Browser
Species Human (GRCh38)
Location 2:179140317-179140339
Sequence CACCCTAAAGACCTTATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942738173_942738182 27 Left 942738173 2:179140317-179140339 CCTAAAATAAGGTCTTTAGGGTG No data
Right 942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG No data
942738173_942738179 14 Left 942738173 2:179140317-179140339 CCTAAAATAAGGTCTTTAGGGTG No data
Right 942738179 2:179140354-179140376 ATATGACTGGTATCCTTATAAGG No data
942738173_942738176 1 Left 942738173 2:179140317-179140339 CCTAAAATAAGGTCTTTAGGGTG No data
Right 942738176 2:179140341-179140363 GCCCAATCTAAATATATGACTGG No data
942738173_942738180 19 Left 942738173 2:179140317-179140339 CCTAAAATAAGGTCTTTAGGGTG No data
Right 942738180 2:179140359-179140381 ACTGGTATCCTTATAAGGAGAGG 0: 3
1: 53
2: 468
3: 1289
4: 2219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942738173 Original CRISPR CACCCTAAAGACCTTATTTT AGG (reversed) Intronic
No off target data available for this crispr