ID: 942738177

View in Genome Browser
Species Human (GRCh38)
Location 2:179140342-179140364
Sequence ACCAGTCATATATTTAGATT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942738177_942738180 -6 Left 942738177 2:179140342-179140364 CCCAATCTAAATATATGACTGGT No data
Right 942738180 2:179140359-179140381 ACTGGTATCCTTATAAGGAGAGG 0: 3
1: 53
2: 468
3: 1289
4: 2219
942738177_942738182 2 Left 942738177 2:179140342-179140364 CCCAATCTAAATATATGACTGGT No data
Right 942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942738177 Original CRISPR ACCAGTCATATATTTAGATT GGG (reversed) Intronic
No off target data available for this crispr