ID: 942738178

View in Genome Browser
Species Human (GRCh38)
Location 2:179140343-179140365
Sequence TACCAGTCATATATTTAGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942738178_942738182 1 Left 942738178 2:179140343-179140365 CCAATCTAAATATATGACTGGTA No data
Right 942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG No data
942738178_942738180 -7 Left 942738178 2:179140343-179140365 CCAATCTAAATATATGACTGGTA No data
Right 942738180 2:179140359-179140381 ACTGGTATCCTTATAAGGAGAGG 0: 3
1: 53
2: 468
3: 1289
4: 2219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942738178 Original CRISPR TACCAGTCATATATTTAGAT TGG (reversed) Intronic
No off target data available for this crispr