ID: 942738178 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:179140343-179140365 |
| Sequence | TACCAGTCATATATTTAGAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 942738178_942738182 | 1 | Left | 942738178 | 2:179140343-179140365 | CCAATCTAAATATATGACTGGTA | No data | ||
| Right | 942738182 | 2:179140367-179140389 | CCTTATAAGGAGAGGAAATCTGG | No data | ||||
| 942738178_942738180 | -7 | Left | 942738178 | 2:179140343-179140365 | CCAATCTAAATATATGACTGGTA | No data | ||
| Right | 942738180 | 2:179140359-179140381 | ACTGGTATCCTTATAAGGAGAGG | 0: 3 1: 53 2: 468 3: 1289 4: 2219 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 942738178 | Original CRISPR | TACCAGTCATATATTTAGAT TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||