ID: 942738182

View in Genome Browser
Species Human (GRCh38)
Location 2:179140367-179140389
Sequence CCTTATAAGGAGAGGAAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942738177_942738182 2 Left 942738177 2:179140342-179140364 CCCAATCTAAATATATGACTGGT No data
Right 942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG No data
942738178_942738182 1 Left 942738178 2:179140343-179140365 CCAATCTAAATATATGACTGGTA No data
Right 942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG No data
942738173_942738182 27 Left 942738173 2:179140317-179140339 CCTAAAATAAGGTCTTTAGGGTG No data
Right 942738182 2:179140367-179140389 CCTTATAAGGAGAGGAAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942738182 Original CRISPR CCTTATAAGGAGAGGAAATC TGG Intronic
No off target data available for this crispr