ID: 942738470

View in Genome Browser
Species Human (GRCh38)
Location 2:179144187-179144209
Sequence ATTTTGCTCTACAGGGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942738470_942738475 3 Left 942738470 2:179144187-179144209 CCTATTTCCCTGTAGAGCAAAAT No data
Right 942738475 2:179144213-179144235 ACTGTGGGATTTCTGTCTGATGG No data
942738470_942738476 29 Left 942738470 2:179144187-179144209 CCTATTTCCCTGTAGAGCAAAAT No data
Right 942738476 2:179144239-179144261 TAATCCAAGTAATATGTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942738470 Original CRISPR ATTTTGCTCTACAGGGAAAT AGG (reversed) Intronic
No off target data available for this crispr