ID: 942743552

View in Genome Browser
Species Human (GRCh38)
Location 2:179206672-179206694
Sequence TCCAGGGAGTAGGGGGCAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942743544_942743552 30 Left 942743544 2:179206619-179206641 CCTAGCTGAACTCTGTAATAATT No data
Right 942743552 2:179206672-179206694 TCCAGGGAGTAGGGGGCAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942743552 Original CRISPR TCCAGGGAGTAGGGGGCAAA TGG Intronic
No off target data available for this crispr