ID: 942745108

View in Genome Browser
Species Human (GRCh38)
Location 2:179222780-179222802
Sequence GACACAGATTTGCCATCCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942745106_942745108 9 Left 942745106 2:179222748-179222770 CCATGTTGTAGATAAGGAAACTA No data
Right 942745108 2:179222780-179222802 GACACAGATTTGCCATCCTAAGG No data
942745105_942745108 14 Left 942745105 2:179222743-179222765 CCTTTCCATGTTGTAGATAAGGA No data
Right 942745108 2:179222780-179222802 GACACAGATTTGCCATCCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942745108 Original CRISPR GACACAGATTTGCCATCCTA AGG Intronic
No off target data available for this crispr