ID: 942745520

View in Genome Browser
Species Human (GRCh38)
Location 2:179227780-179227802
Sequence GAAAATGAGCAGAGGCAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942745512_942745520 14 Left 942745512 2:179227743-179227765 CCTGTGGAGCTCTTGACATTACT No data
Right 942745520 2:179227780-179227802 GAAAATGAGCAGAGGCAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942745520 Original CRISPR GAAAATGAGCAGAGGCAGCA GGG Intronic
No off target data available for this crispr