ID: 942745690

View in Genome Browser
Species Human (GRCh38)
Location 2:179229385-179229407
Sequence CTGAGGACTAGGAGCAACAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942745690_942745694 -6 Left 942745690 2:179229385-179229407 CCATTGTTGCTCCTAGTCCTCAG No data
Right 942745694 2:179229402-179229424 CCTCAGGCCTTCAGACTGACTGG No data
942745690_942745696 9 Left 942745690 2:179229385-179229407 CCATTGTTGCTCCTAGTCCTCAG No data
Right 942745696 2:179229417-179229439 CTGACTGGAATTTACACCACAGG No data
942745690_942745697 19 Left 942745690 2:179229385-179229407 CCATTGTTGCTCCTAGTCCTCAG No data
Right 942745697 2:179229427-179229449 TTTACACCACAGGTCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942745690 Original CRISPR CTGAGGACTAGGAGCAACAA TGG (reversed) Intronic
No off target data available for this crispr