ID: 942746435

View in Genome Browser
Species Human (GRCh38)
Location 2:179239371-179239393
Sequence AGTCATCTGCAGGAAGTACA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942746431_942746435 12 Left 942746431 2:179239336-179239358 CCAGCTCATAGTTCATATAATGA No data
Right 942746435 2:179239371-179239393 AGTCATCTGCAGGAAGTACAAGG No data
942746430_942746435 23 Left 942746430 2:179239325-179239347 CCTTTTGCAAACCAGCTCATAGT No data
Right 942746435 2:179239371-179239393 AGTCATCTGCAGGAAGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942746435 Original CRISPR AGTCATCTGCAGGAAGTACA AGG Intronic
No off target data available for this crispr