ID: 942748470

View in Genome Browser
Species Human (GRCh38)
Location 2:179263666-179263688
Sequence GACAGCCCCCGTGGTTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942748470_942748474 13 Left 942748470 2:179263666-179263688 CCAAGAAAACCACGGGGGCTGTC No data
Right 942748474 2:179263702-179263724 AGTCCAAACCGTGCATCCCAGGG No data
942748470_942748473 12 Left 942748470 2:179263666-179263688 CCAAGAAAACCACGGGGGCTGTC No data
Right 942748473 2:179263701-179263723 AAGTCCAAACCGTGCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942748470 Original CRISPR GACAGCCCCCGTGGTTTTCT TGG (reversed) Intronic
No off target data available for this crispr