ID: 942748473

View in Genome Browser
Species Human (GRCh38)
Location 2:179263701-179263723
Sequence AAGTCCAAACCGTGCATCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942748470_942748473 12 Left 942748470 2:179263666-179263688 CCAAGAAAACCACGGGGGCTGTC No data
Right 942748473 2:179263701-179263723 AAGTCCAAACCGTGCATCCCAGG No data
942748471_942748473 3 Left 942748471 2:179263675-179263697 CCACGGGGGCTGTCAGAGCAACA No data
Right 942748473 2:179263701-179263723 AAGTCCAAACCGTGCATCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942748473 Original CRISPR AAGTCCAAACCGTGCATCCC AGG Intronic
No off target data available for this crispr