ID: 942756311

View in Genome Browser
Species Human (GRCh38)
Location 2:179345428-179345450
Sequence TTGTACAAGAAGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942756311_942756317 29 Left 942756311 2:179345428-179345450 CCTTCCTCCTTCTTCTTGTACAA No data
Right 942756317 2:179345480-179345502 AAGAGGAGAAAATGAGTGCTAGG No data
942756311_942756316 12 Left 942756311 2:179345428-179345450 CCTTCCTCCTTCTTCTTGTACAA No data
Right 942756316 2:179345463-179345485 AGCATAGTAAAATCTTAAAGAGG No data
942756311_942756318 30 Left 942756311 2:179345428-179345450 CCTTCCTCCTTCTTCTTGTACAA No data
Right 942756318 2:179345481-179345503 AGAGGAGAAAATGAGTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942756311 Original CRISPR TTGTACAAGAAGAAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr