ID: 942756317

View in Genome Browser
Species Human (GRCh38)
Location 2:179345480-179345502
Sequence AAGAGGAGAAAATGAGTGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942756310_942756317 30 Left 942756310 2:179345427-179345449 CCCTTCCTCCTTCTTCTTGTACA No data
Right 942756317 2:179345480-179345502 AAGAGGAGAAAATGAGTGCTAGG No data
942756313_942756317 25 Left 942756313 2:179345432-179345454 CCTCCTTCTTCTTGTACAAAGGC No data
Right 942756317 2:179345480-179345502 AAGAGGAGAAAATGAGTGCTAGG No data
942756314_942756317 22 Left 942756314 2:179345435-179345457 CCTTCTTCTTGTACAAAGGCTTT No data
Right 942756317 2:179345480-179345502 AAGAGGAGAAAATGAGTGCTAGG No data
942756311_942756317 29 Left 942756311 2:179345428-179345450 CCTTCCTCCTTCTTCTTGTACAA No data
Right 942756317 2:179345480-179345502 AAGAGGAGAAAATGAGTGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942756317 Original CRISPR AAGAGGAGAAAATGAGTGCT AGG Intergenic
No off target data available for this crispr