ID: 942756318

View in Genome Browser
Species Human (GRCh38)
Location 2:179345481-179345503
Sequence AGAGGAGAAAATGAGTGCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942756311_942756318 30 Left 942756311 2:179345428-179345450 CCTTCCTCCTTCTTCTTGTACAA No data
Right 942756318 2:179345481-179345503 AGAGGAGAAAATGAGTGCTAGGG No data
942756314_942756318 23 Left 942756314 2:179345435-179345457 CCTTCTTCTTGTACAAAGGCTTT No data
Right 942756318 2:179345481-179345503 AGAGGAGAAAATGAGTGCTAGGG No data
942756313_942756318 26 Left 942756313 2:179345432-179345454 CCTCCTTCTTCTTGTACAAAGGC No data
Right 942756318 2:179345481-179345503 AGAGGAGAAAATGAGTGCTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942756318 Original CRISPR AGAGGAGAAAATGAGTGCTA GGG Intergenic
No off target data available for this crispr