ID: 942761149

View in Genome Browser
Species Human (GRCh38)
Location 2:179399766-179399788
Sequence AAACTGGGAATCTCATAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 156}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942761149_942761155 10 Left 942761149 2:179399766-179399788 CCTTCCTATGAGATTCCCAGTTT 0: 1
1: 0
2: 0
3: 17
4: 156
Right 942761155 2:179399799-179399821 ATTGGTCAGTGCTGTAAGTTTGG 0: 1
1: 0
2: 0
3: 8
4: 116
942761149_942761156 13 Left 942761149 2:179399766-179399788 CCTTCCTATGAGATTCCCAGTTT 0: 1
1: 0
2: 0
3: 17
4: 156
Right 942761156 2:179399802-179399824 GGTCAGTGCTGTAAGTTTGGAGG 0: 1
1: 0
2: 1
3: 5
4: 112
942761149_942761152 -8 Left 942761149 2:179399766-179399788 CCTTCCTATGAGATTCCCAGTTT 0: 1
1: 0
2: 0
3: 17
4: 156
Right 942761152 2:179399781-179399803 CCCAGTTTCCTGTTATGCATTGG 0: 1
1: 0
2: 0
3: 12
4: 130
942761149_942761157 21 Left 942761149 2:179399766-179399788 CCTTCCTATGAGATTCCCAGTTT 0: 1
1: 0
2: 0
3: 17
4: 156
Right 942761157 2:179399810-179399832 CTGTAAGTTTGGAGGTCTCAAGG 0: 1
1: 1
2: 1
3: 7
4: 155

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942761149 Original CRISPR AAACTGGGAATCTCATAGGA AGG (reversed) Intergenic
904344475 1:29859092-29859114 AAACTGGGATTCACAGAGGTTGG + Intergenic
908979737 1:69941260-69941282 AAAATGGGAAGCTCTTTGGAAGG + Intronic
909351503 1:74658760-74658782 AAACTGGGTATTTCAGAGGGTGG - Intronic
909507574 1:76411022-76411044 AAATGTGGAATCTCATAGAAGGG + Intronic
912906090 1:113708809-113708831 ATACTGCAAATCTCAAAGGAGGG + Intronic
915254623 1:154616935-154616957 ACAATGGGTATCTCAGAGGAGGG + Intronic
915881168 1:159673096-159673118 AAATTGAGAAACTCAGAGGAGGG - Intergenic
916068695 1:161157156-161157178 AGCCTGGGAGACTCATAGGATGG - Intronic
916155969 1:161848573-161848595 AAACTGGGACACTCTTAAGAAGG + Intronic
918498879 1:185171533-185171555 AAGCTAGGAATGTCATTGGAGGG - Intronic
1063556788 10:7087956-7087978 AAATTGGGAATGCCAAAGGAAGG + Intergenic
1064730755 10:18328306-18328328 TAAGTTGGAATCTCATAGGGTGG + Intronic
1067708906 10:48633265-48633287 GACCTGGGAGTCTCAGAGGAAGG - Intronic
1068555378 10:58453070-58453092 CAACTGGGTATCTCAAATGAGGG - Intergenic
1069644000 10:69978666-69978688 ATACTGGGAATCTGAGAAGAAGG + Intergenic
1070010241 10:72466471-72466493 AAACTGGAAACCTCTAAGGATGG + Intronic
1070982916 10:80664621-80664643 AAACTTGGAAACTCACAGGCAGG - Intergenic
1071288147 10:84167673-84167695 AAACTGAGAGTCTCAAAGGGGGG - Intergenic
1073722659 10:106191093-106191115 TAAATGGGAATCTCTGAGGATGG - Intergenic
1074211594 10:111340317-111340339 AAACTTGCAATCACAGAGGAGGG + Intergenic
1074437232 10:113444561-113444583 AAACTGGGATTCTCTTGGTAAGG + Intergenic
1074550109 10:114434860-114434882 AGACTGGGAACCACAGAGGAAGG - Intronic
1077670412 11:4152095-4152117 AAACTGGGAACCACAGAGGCAGG + Intergenic
1078659406 11:13275067-13275089 AAGATGAGAATCTCAGAGGAAGG + Intergenic
1079055640 11:17204302-17204324 AAAATGGGAGTCACATAGGTAGG - Intronic
1080288018 11:30639227-30639249 AAACTGGGAATGTGATTGGTGGG + Intergenic
1081826110 11:46053902-46053924 AAGCCTGGAATCTCATTGGAGGG - Intronic
1082822207 11:57551766-57551788 GAACTGGCAATCTAACAGGATGG + Exonic
1086597240 11:88587444-88587466 AAACTAGAAAGATCATAGGAGGG + Intronic
1087111551 11:94474983-94475005 AAACTGTGAGTTTCAAAGGAGGG - Intronic
1089711565 11:120318611-120318633 AAAATGGTAAGCTCCTAGGAGGG - Exonic
1091970182 12:4780221-4780243 AAACAGGGAATCCCATAGGTGGG - Intronic
1093224640 12:16466910-16466932 AAACTGGGATTATCAGTGGAGGG - Intronic
1094342510 12:29428699-29428721 AATCTGGAACTATCATAGGAGGG + Intronic
1096721382 12:53525371-53525393 AAAAAGGGAATCTTATAGGCAGG + Intronic
1098045750 12:66398587-66398609 AAGCTGTGGGTCTCATAGGAAGG - Intronic
1104381791 12:128313709-128313731 AAACTGGGATCCTGTTAGGAAGG + Intronic
1104807335 12:131598071-131598093 GAACAGGGAATCTCTTTGGAAGG + Intergenic
1105554374 13:21432013-21432035 AAACTGTGACTTTCATAGGTTGG - Intronic
1106786245 13:33110669-33110691 AAAAAGGTAATCTCAGAGGATGG - Exonic
1108102570 13:46972626-46972648 AAACTGTGTATGTAATAGGAAGG + Intergenic
1109023311 13:57127922-57127944 AAATTGATAATCACATAGGATGG - Intergenic
1109234600 13:59799530-59799552 AAACGGGGAATTTCATAGTTAGG - Intronic
1109606063 13:64697545-64697567 AAACTTTGAATGACATAGGAGGG + Intergenic
1110434132 13:75460312-75460334 AAACAGGGAAGCACAAAGGAAGG + Intronic
1110517411 13:76431099-76431121 TAACTGTCATTCTCATAGGATGG - Intergenic
1112273860 13:97997295-97997317 GATTTGGGAATTTCATAGGAGGG + Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119605356 14:76011347-76011369 AAACTGGAAATCAAATTGGAAGG + Intronic
1120102683 14:80463447-80463469 ATACAGCGAAGCTCATAGGAAGG - Intergenic
1121789385 14:96687452-96687474 AAACTGGGACCCACATCGGAAGG + Intergenic
1125460585 15:39902947-39902969 AAAGTGGAACTCTCATAGGTTGG - Intronic
1130909254 15:88259736-88259758 AAACTGGGTATCTCAGAGGCAGG + Intergenic
1133669044 16:7999728-7999750 AAACTGGGAAACTCATAACCTGG - Intergenic
1135950677 16:26911267-26911289 ACACTGGGGATCTCAAAAGAGGG + Intergenic
1137687251 16:50394722-50394744 GAACTGGGGATCTCAGAGGATGG - Intergenic
1137784543 16:51127233-51127255 AAACAGGAAATCTGAGAGGAAGG - Intergenic
1140307871 16:73820461-73820483 AAACTGTGAATCTCATGGTATGG - Intergenic
1140720957 16:77771744-77771766 TAACTGGGGATTTCATGGGAAGG - Intergenic
1141249239 16:82339722-82339744 AAACTGGGGCTTTCAGAGGAAGG + Intergenic
1144302096 17:13931078-13931100 AAACTGGCATTCTCTTGGGAAGG - Intergenic
1144471329 17:15544448-15544470 AAAGGAGGAAACTCATAGGAAGG + Intronic
1144925139 17:18800245-18800267 AAAGGAGGAAACTCATAGGAAGG - Intronic
1146172390 17:30644057-30644079 AAATGGGGAATTTCATTGGAAGG + Intergenic
1146345844 17:32060068-32060090 AAATGGGGAATTTCATTGGAAGG + Intergenic
1146422645 17:32702877-32702899 AAACTGGAAAACTCATAGCATGG + Intronic
1149268706 17:54954309-54954331 TAACTGGAAATCCCATAGTAAGG - Intronic
1150944215 17:69726889-69726911 AAACTGAGACTCTCAGATGACGG - Intergenic
1151402900 17:73867741-73867763 AAACTGTGGATCACATGGGAAGG - Intergenic
1156751064 18:40455702-40455724 AAACTGAGAATGTCATGGGCTGG + Intergenic
1159263059 18:66041572-66041594 AAACCAGGAATTTAATAGGATGG - Intergenic
1161534982 19:4813414-4813436 AAACGGGGAATCACAATGGAAGG - Intergenic
1164155166 19:22590906-22590928 TAAATGGTAATCTCATTGGATGG - Intergenic
1165830392 19:38727727-38727749 AACCTCGGAAGCTCAAAGGAAGG - Intronic
927923660 2:26993687-26993709 AACCTGGCAATCTCATGGGGAGG - Intronic
929101612 2:38320225-38320247 AAACTGGTTATCTCATTAGATGG + Intronic
929129789 2:38555717-38555739 CAATTGGGAATCCCATGGGATGG + Intergenic
929409331 2:41679055-41679077 AAAATGGTAATCCCATGGGAAGG - Intergenic
929944726 2:46361838-46361860 AGACTGGGGTTGTCATAGGAGGG + Intronic
930340957 2:50113808-50113830 AACTTGGGAGTTTCATAGGAAGG - Intronic
932267915 2:70384227-70384249 AAGCTGGGTATCTCAAAGCAGGG - Intergenic
932841691 2:75088945-75088967 AAACTGTCAAACTCACAGGAGGG - Intronic
938767415 2:134469526-134469548 CAACTGGGAACCACGTAGGAAGG - Intronic
940336950 2:152539249-152539271 AAGCTGGGAATCTCAATGGAGGG - Intronic
940448730 2:153811261-153811283 AAAGTGGGTATCACTTAGGATGG + Intergenic
941556319 2:166987029-166987051 AACCTGGGAATCTAAATGGAGGG + Intronic
941879105 2:170463500-170463522 CATCTGGGCATCTCATAAGAAGG - Intronic
942610975 2:177742298-177742320 AAACTGGGATTGTCATACTAGGG - Intronic
942761149 2:179399766-179399788 AAACTGGGAATCTCATAGGAAGG - Intergenic
945679939 2:212901961-212901983 TATCTGGGAATTTCATATGAAGG + Intergenic
945839231 2:214868402-214868424 AAACTGGCATTCTCATCTGAGGG + Intergenic
946437810 2:219669691-219669713 AAACTGGGAGTATGAGAGGAGGG + Intergenic
946707340 2:222471325-222471347 AAACTGGGAACCTCTTAGTGAGG + Intronic
947343581 2:229166589-229166611 TACTTGGGAATCTCTTAGGAAGG - Intronic
947845323 2:233239172-233239194 AAACTGGGTCTCTCTCAGGAAGG - Intronic
947847954 2:233260806-233260828 AAAGTAGGAATCTCCTAGGAAGG - Intronic
948473403 2:238201619-238201641 CAACTCAGAATCTCATAGGTTGG - Intronic
1169685020 20:8261478-8261500 AAAGCTGGAATCTTATAGGAAGG - Intronic
1171127264 20:22613413-22613435 AAGCTGGGAATCTGACAGCAAGG + Intergenic
1179557319 21:42188006-42188028 AAAATGGGAATCACTTTGGAGGG + Intergenic
1180050287 21:45327941-45327963 ACACAGGGAATCACACAGGATGG + Intergenic
1185161001 22:49229840-49229862 AAACTGAGAATGTCATCAGAAGG - Intergenic
949789864 3:7781317-7781339 ATACTGGGTAGCTCATATGATGG - Intergenic
952809259 3:37386884-37386906 AATCTGGGCCTCTCAGAGGAAGG + Intronic
953813319 3:46132848-46132870 AAACTGGGCTTCTTATAGTAGGG - Intergenic
956310696 3:67876259-67876281 AAACTGGGAAGCTGTTAGCAAGG - Intergenic
957668782 3:83273170-83273192 AAAATGGGAATATGATAGTATGG - Intergenic
962297240 3:134201861-134201883 CAACTGGAAATCACAGAGGAGGG + Intronic
963177631 3:142316961-142316983 AAACTGTGAATCTAATACAAAGG - Intronic
964548895 3:157865244-157865266 GAAGTGGCAATCTCATTGGAAGG + Intergenic
967609989 3:191492892-191492914 GAAGTGGGAATCTCATGGTATGG + Intergenic
967831087 3:193920780-193920802 ATCCTGGTAACCTCATAGGATGG - Intergenic
969984334 4:11191535-11191557 AAACTTGGAATCTACTAAGAGGG - Intergenic
974269426 4:59631242-59631264 AAACAGGTAGTCTCAAAGGAAGG - Intergenic
975052678 4:69884768-69884790 AAACTTAGAATCACAGAGGAAGG + Intergenic
977268631 4:94886802-94886824 AAACTGGGAATCACTTAGGGAGG + Intronic
978035418 4:103986571-103986593 ATTCTGGGACTCTGATAGGAGGG + Intergenic
978872349 4:113594483-113594505 AAACTGTGAATCATATATGAAGG + Intronic
979191177 4:117860481-117860503 AAACTGGGTCTCTCATATCAGGG + Intergenic
981754401 4:148125514-148125536 AAACTAGGAAATTCATAGGCAGG - Intronic
983856459 4:172652331-172652353 AAACAAGAAATCTCTTAGGATGG + Intronic
984332888 4:178349380-178349402 AAAATGGGAATCTCCTGAGAGGG + Intergenic
984685413 4:182662163-182662185 GAACTGGGTATCACATAAGAAGG + Intronic
987930260 5:24392295-24392317 AAAGTGAGAATCTCAAAGGGGGG - Intergenic
990203312 5:53402231-53402253 AAGGAGGGAATCTCAGAGGAGGG - Intergenic
990819016 5:59816755-59816777 AAACTGGGTATTTCTTAGGAAGG - Intronic
996548721 5:124708069-124708091 AAACTGAAGATCTCAGAGGATGG + Intronic
999440747 5:151598808-151598830 AACCTGGGAAGCTCAAAGCATGG - Intergenic
999882257 5:155878648-155878670 AAATTGGGATTCTCTTAGCAAGG + Intronic
1001755396 5:174164705-174164727 AAACTGAGAAGCTCAGAAGAAGG - Intronic
1007276759 6:40679772-40679794 AAACTGGGGCTCTCTGAGGATGG - Intergenic
1008360748 6:50615159-50615181 AAACTGAGTAGCTCATAGGAAGG + Intergenic
1008526588 6:52413380-52413402 AAACTGTCAATTTCATAGGGAGG - Intergenic
1011460127 6:87594117-87594139 AAAATGGGCATCTCATGGGAGGG + Intronic
1011596268 6:89019752-89019774 AAACTGGGAGTCTGTTAGGATGG - Intergenic
1014055675 6:117012722-117012744 AAACTGGCAATATCATAGTCTGG + Intergenic
1014694294 6:124599577-124599599 AAACTGAGCATCTCTTAAGATGG + Intronic
1015665843 6:135627705-135627727 AAACTGCTGAGCTCATAGGAGGG + Intergenic
1016232627 6:141824751-141824773 AAACTGGGAAATTCAAAGGAAGG - Intergenic
1017592983 6:155996945-155996967 AAACAAAGAATCTCATATGATGG + Intergenic
1023209214 7:37784984-37785006 AAACTGAGAATCTCAGAGCCAGG - Intronic
1023519017 7:41032260-41032282 AAACTGGGATTCTATTAGCAAGG - Intergenic
1024802254 7:53093691-53093713 TAACTGAGAATCTCAGAGAATGG + Intergenic
1026346582 7:69479797-69479819 AAAGTGGGAATATCATAACAGGG + Intergenic
1030113916 7:106049115-106049137 AAACTGGGAATCTCAGACTTCGG + Intergenic
1035184553 7:157116019-157116041 AAATGGTGAATCTGATAGGAAGG + Intergenic
1040316354 8:46262947-46262969 ATGCTGGGAGTCTCATAAGAAGG + Intergenic
1045706730 8:104932046-104932068 AAATAGGAAATCTTATAGGAAGG + Intronic
1046168813 8:110477606-110477628 AAACTGTTAATCTCTTAGGAAGG - Intergenic
1047511363 8:125518283-125518305 AAACTGAGACTCTCAGCGGAAGG - Intergenic
1047964579 8:130036454-130036476 AGACTGGTTATCTCAGAGGAGGG - Intergenic
1049642855 8:143723197-143723219 AGTCTGGGAAGCTCATAGGCCGG + Intergenic
1050283562 9:4077875-4077897 AAACTTAGAAGCTCAGAGGAAGG - Intronic
1050395530 9:5191068-5191090 ACCCTGGGAATCTCACAGTAGGG + Intergenic
1050405429 9:5304154-5304176 TCACTGGGAATCTCACCGGACGG - Intronic
1050408731 9:5339320-5339342 TCACTGGGAATCTCACCGGACGG - Intronic
1051045057 9:12863066-12863088 AAACTGGAAATCTCGTATGAAGG - Intergenic
1051752007 9:20352236-20352258 AAATAGTGAGTCTCATAGGAGGG - Intronic
1055064136 9:72101558-72101580 AAAATGAGAATTTCAGAGGAAGG + Intergenic
1055453298 9:76450161-76450183 AAACTGGTATTTTCATAGGGTGG - Intronic
1057014316 9:91637510-91637532 AAACTTAAAATCTCAGAGGAGGG - Intronic
1057106079 9:92418467-92418489 AAACTGGGACTCTTAAAAGATGG - Intronic
1057477700 9:95417395-95417417 AAATTGGGAATCTTATAAAAAGG + Intergenic
1057967297 9:99516688-99516710 AAGCTCAGAATCTCATGGGAAGG - Intergenic
1058416985 9:104799732-104799754 AAAATGTGAATCTCATTGTAGGG - Intronic
1058523509 9:105835164-105835186 GCACTGGGAATCTCATGGTAAGG - Intergenic
1058719093 9:107747416-107747438 AAACTGGGCATCTCAGAGCACGG - Intergenic
1059019010 9:110553119-110553141 CAACTGGGCATCTCAGAGGATGG + Intronic
1059151540 9:111953805-111953827 AACATGGCAATCACATAGGAGGG + Intergenic
1191000097 X:55650621-55650643 AAACTAGAAAGATCATAGGAGGG + Intergenic
1191294707 X:58848371-58848393 AAACCTGAAATCTCAAAGGAAGG - Intergenic
1191305114 X:58987043-58987065 AAACCTGAAATCTCAAAGGAAGG - Intergenic
1191330624 X:59328278-59328300 AAACCTGAAATCTCAAAGGAAGG - Intergenic
1197685542 X:129435975-129435997 AGACTGGGAATCTGATTGGCTGG - Intergenic