ID: 942763437

View in Genome Browser
Species Human (GRCh38)
Location 2:179427235-179427257
Sequence CCACATGTGTGGCACCTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942763430_942763437 10 Left 942763430 2:179427202-179427224 CCCCAGGCTTTGGTGGGTTCTCC No data
Right 942763437 2:179427235-179427257 CCACATGTGTGGCACCTCCATGG No data
942763425_942763437 18 Left 942763425 2:179427194-179427216 CCCCAGCTCCCCAGGCTTTGGTG No data
Right 942763437 2:179427235-179427257 CCACATGTGTGGCACCTCCATGG No data
942763432_942763437 8 Left 942763432 2:179427204-179427226 CCAGGCTTTGGTGGGTTCTCCCA No data
Right 942763437 2:179427235-179427257 CCACATGTGTGGCACCTCCATGG No data
942763422_942763437 29 Left 942763422 2:179427183-179427205 CCTGGGTGAGTCCCCAGCTCCCC No data
Right 942763437 2:179427235-179427257 CCACATGTGTGGCACCTCCATGG No data
942763431_942763437 9 Left 942763431 2:179427203-179427225 CCCAGGCTTTGGTGGGTTCTCCC No data
Right 942763437 2:179427235-179427257 CCACATGTGTGGCACCTCCATGG No data
942763428_942763437 16 Left 942763428 2:179427196-179427218 CCAGCTCCCCAGGCTTTGGTGGG No data
Right 942763437 2:179427235-179427257 CCACATGTGTGGCACCTCCATGG No data
942763426_942763437 17 Left 942763426 2:179427195-179427217 CCCAGCTCCCCAGGCTTTGGTGG No data
Right 942763437 2:179427235-179427257 CCACATGTGTGGCACCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942763437 Original CRISPR CCACATGTGTGGCACCTCCA TGG Intergenic
No off target data available for this crispr