ID: 942769074

View in Genome Browser
Species Human (GRCh38)
Location 2:179494680-179494702
Sequence AACTGGTTGCTGAATCTAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942769074_942769076 6 Left 942769074 2:179494680-179494702 CCTCTTAGATTCAGCAACCAGTT No data
Right 942769076 2:179494709-179494731 ACTTTGTTGTGTATCCTGCCAGG No data
942769074_942769077 7 Left 942769074 2:179494680-179494702 CCTCTTAGATTCAGCAACCAGTT No data
Right 942769077 2:179494710-179494732 CTTTGTTGTGTATCCTGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942769074 Original CRISPR AACTGGTTGCTGAATCTAAG AGG (reversed) Intronic
No off target data available for this crispr