ID: 942771374

View in Genome Browser
Species Human (GRCh38)
Location 2:179524998-179525020
Sequence ATGTCTGCCTCGAGTGATGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942771374_942771375 5 Left 942771374 2:179524998-179525020 CCATCATCACTCGAGGCAGACAT No data
Right 942771375 2:179525026-179525048 TTATCCTCCTTTAACAAACGAGG No data
942771374_942771378 14 Left 942771374 2:179524998-179525020 CCATCATCACTCGAGGCAGACAT No data
Right 942771378 2:179525035-179525057 TTTAACAAACGAGGAATCAAAGG No data
942771374_942771379 24 Left 942771374 2:179524998-179525020 CCATCATCACTCGAGGCAGACAT No data
Right 942771379 2:179525045-179525067 GAGGAATCAAAGGCTTTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942771374 Original CRISPR ATGTCTGCCTCGAGTGATGA TGG (reversed) Intronic
No off target data available for this crispr