ID: 942779235

View in Genome Browser
Species Human (GRCh38)
Location 2:179621654-179621676
Sequence CACCTAGACCTGCTGTAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942779235_942779239 9 Left 942779235 2:179621654-179621676 CCCTGTTACAGCAGGTCTAGGTG No data
Right 942779239 2:179621686-179621708 ATAAGAAACAAGATTTCATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942779235 Original CRISPR CACCTAGACCTGCTGTAACA GGG (reversed) Intronic
No off target data available for this crispr