ID: 942779573

View in Genome Browser
Species Human (GRCh38)
Location 2:179625518-179625540
Sequence ATATATAAACAGATGAATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
942779572_942779573 -7 Left 942779572 2:179625502-179625524 CCTTTTATATGCATAAATATATA No data
Right 942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG No data
942779571_942779573 13 Left 942779571 2:179625482-179625504 CCTTAATAAGCGGCTACAATCCT No data
Right 942779573 2:179625518-179625540 ATATATAAACAGATGAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
942779573 Original CRISPR ATATATAAACAGATGAATAA AGG Intronic
No off target data available for this crispr